Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9149

Psmg1 proteasome (prosome, macropain) assembly chaperone 1 ( MGI:1860263)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9149 EMAGE:9149 EMAGE:9149 EMAGE:9149 EMAGE:9149
"Pseudo-wholemount" of euxassay_007189. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007189_01 euxassay_007189_02 euxassay_007189_03 euxassay_007189_04
EMAGE:9149 EMAGE:9149 EMAGE:9149 EMAGE:9149 EMAGE:9149
euxassay_007189_05 euxassay_007189_06 euxassay_007189_07 euxassay_007189_08 euxassay_007189_09
EMAGE:9149 EMAGE:9149 EMAGE:9149 EMAGE:9149 EMAGE:9149
euxassay_007189_10 euxassay_007189_11 euxassay_007189_12 euxassay_007189_13 euxassay_007189_14
EMAGE:9149 EMAGE:9149 EMAGE:9149 EMAGE:9149 EMAGE:9149
euxassay_007189_15 euxassay_007189_16 euxassay_007189_17 euxassay_007189_18 euxassay_007189_19
EMAGE:9149 EMAGE:9149 EMAGE:9149 EMAGE:9149 EMAGE:9149
euxassay_007189_20 euxassay_007189_21 euxassay_007189_22 euxassay_007189_23 euxassay_007189_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9149Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9149_wholemount_strong.wlz
9149_wholemount_moderate.wlz
9149_wholemount_weak.wlz
9149_wholemount_possible.wlz
9149_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9149_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 09 10 11 17 18 19 20
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 13 14 15 16
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 14 15 16
olfactory cortex ventricular layer
strong strong
regionalstrong expression: see section 12 13 17 18 19
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 17 18 19 20 21 22 23 moderate expression: see section 04
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 17 18 19 20 21 22 23
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 16 17 18 19 20 21 22 23
midbrain ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T50006
Entity Detected:Psmg1, proteasome (prosome, macropain) assembly chaperone 1 ( MGI:1860263)
Sequence:sense strand is shown

>T50006
ACTGAGGAGGAAGAAGAGGAGGAGGAGCAGAGCAGGCGGGACACGCCGGAGGACCGGGAGGTCCGGCGGC
AGCTGGCGCGGAAGAGGGAGGTTCGGCTTCTCCGAAGACAGACAGAAACATCTCTGGAGGCTGTGCTCCT
AGAGACACACCCTTGCTCCAAGTTTATAATTGCAGTAGGAAGCAACGCAACAGCATTCCTGTCAGCGTTT
GTTATGAACTCGGGAGTCTGGGAAGAAGTCGGTTGTGCTAAGCTCTGGAATGAATGGTGCAGAACTACAG
ACACTGTCCGTCTGTCCCCTACAGATGTTTTCTGTGTGTTTTATCAACTGAAATCAGATCCCTCGGTTTT
TCTATGTCAGTGTAGCTGCTACATTGCTGAGGATCAGCAGTTCCAGTGGTTGGAGAAGGTTTTCGGCTTC
CAACCCAGAAAGAGCATGCAGGTAACCGTTCTCACATGCCGGCACATCACAGACTACAAGACCCCCGAGT
CTACCTGCAGCCTTTCCTCTCCTTTCCTGAGAGCCCTAAAAACTCAGACATTCAAAGATGCCCTCTGCTG
CCCACTGCTGGAACAGCCGAACATTGTGCATGACCTGTCTGCAGCAGTTCTGAGCTACTGTCAAGTATGG
AAAATCCCTGCGGTTCTGTATCTGTGCTACACTGATGTGATGAAGTTGGACCGTGTCACGGTTGAAGCTT
TTAAACCGTTACTTTCTTCCAGGAGCTTGAAATGCTTGGTGAAGAACATTCCTGAAAGCACAGAAATTCT
GAAGAAGTTGATGACCACAAATGAGATTCAGAGCAACATTTACACATGA
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:ACTGAGGAGGAAGAAGAGGAG; Reverse Primer - name:unspecified, sequence:TCATGTGTAAATGTTGCTCTG. The reverse primer contains a 5' extension containing an T7 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using T7 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4827494 same experiment
 EurExpress:euxassay_007189 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS