Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9173

Nrip1 nuclear receptor interacting protein 1 ( MGI:1315213)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9173 EMAGE:9173 EMAGE:9173 EMAGE:9173 EMAGE:9173
"Pseudo-wholemount" of euxassay_019638. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019638_01 euxassay_019638_02 euxassay_019638_03 euxassay_019638_04
EMAGE:9173 EMAGE:9173 EMAGE:9173 EMAGE:9173 EMAGE:9173
euxassay_019638_05 euxassay_019638_06 euxassay_019638_07 euxassay_019638_08 euxassay_019638_09
EMAGE:9173 EMAGE:9173 EMAGE:9173 EMAGE:9173 EMAGE:9173
euxassay_019638_10 euxassay_019638_11 euxassay_019638_12 euxassay_019638_13 euxassay_019638_14
EMAGE:9173 EMAGE:9173 EMAGE:9173 EMAGE:9173 EMAGE:9173
euxassay_019638_15 euxassay_019638_16 euxassay_019638_17 euxassay_019638_18 euxassay_019638_19
EMAGE:9173 EMAGE:9173 EMAGE:9173 EMAGE:9173 EMAGE:9173
euxassay_019638_20 euxassay_019638_21 euxassay_019638_22 euxassay_019638_23 euxassay_019638_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9173Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9173_wholemount_strong.wlz
9173_wholemount_moderate.wlz
9173_wholemount_weak.wlz
9173_wholemount_possible.wlz
9173_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9173_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 08 09 10 11
sublingual gland primordium
weak weak
regionalweak expression: see section 06 07 14 15 16
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 weak expression: see section 09 10 12 13
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 19 20 21 weak expression: see section 01 02 03 04 05 08 09 10 11 15 16 17 18 22 23
olfactory cortex mantle layer
weak weak
regionalweak expression: see section 09 10 11 14 15 16
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 weak expression: see section 10 11 12 13
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 07 09 weak expression: see section 06 08 11
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 07 08 moderate expression: see section 15 weak expression: see section 09 17 18
tongue muscle
weak weak
regionalweak expression: see section 11 12 13
stomach
moderate moderate
regionalmoderate expression: see section 17 18 19 20 21 22
midgut
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 09 10 14 weak expression: see section 13
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 09 10 14 15 weak expression: see section 11 16
metanephros
weak weak
regionalweak expression: see section 03 04 05 06 13 14 15 16
male reproductive system
weak weak
regionalweak expression: see section 09
urethra of male
weak weak
regionalweak expression: see section 09 10
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55134
Entity Detected:Nrip1, nuclear receptor interacting protein 1 ( MGI:1315213)
Sequence:sense strand is shown

>T55134
TCTACGGGTCGTTGCTTCATCAGGAAGAGCTGAAGTTTAGCAGGAATGAGCTCGATTATAAATACCCTGC
TGGGCATAGTTCAGCCAGCGATGGTGACCACAGGAGTTGGGCCAGAGAGAGCAAAAGCTTCAATGTTCTC
AAGCAGCTGCTGCTCTCCGAGAACTGTGTGCGAGATCTGTCCCCACACAGGAGTGACTCTGTCCCCGACA
CGAAAAAGAAAGGACACAAAAACAACGCGCCCGGCAGCAAACCTGAATTCGGCATTTCTTCTTTAAATGG
ACTGATGTATAGTTCCCCGCAGCCTGGCAGTTGTGTGACGGATCATAGGACATTTTCATACCCGGGAATG
GTAAAGACCCCTCTGAGCCCTCCTTTCCCAGAGCACTTGGGCTGTGTGGGGTCCAGACCAGAACCTGGGC
TTTTGAATGGATGTTCCGTGCCCGGTGAGAAGGGACCCATTAAGTGGGTCATCACAGATATGGATAAGAA
TGAATACGAAAAAGACTCTCCAAGACTGACCAAAACTAATCCGATCCTCTATTACATGCTCCAGAAGGGA
GGGGGCAATTCTGTTACCAC
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:unspecified; Reverse Primer - name:unspecified, sequence:unspecified. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4826792 same experiment
 EurExpress:euxassay_019638 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS