Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9206

Ap2b1 adaptor-related protein complex 2, beta 1 subunit ( MGI:1919020)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9206 EMAGE:9206 EMAGE:9206 EMAGE:9206 EMAGE:9206
"Pseudo-wholemount" of euxassay_018128. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_018128_01 euxassay_018128_02 euxassay_018128_03 euxassay_018128_04
EMAGE:9206 EMAGE:9206 EMAGE:9206 EMAGE:9206 EMAGE:9206
euxassay_018128_05 euxassay_018128_06 euxassay_018128_07 euxassay_018128_08 euxassay_018128_09
EMAGE:9206 EMAGE:9206 EMAGE:9206 EMAGE:9206 EMAGE:9206
euxassay_018128_10 euxassay_018128_11 euxassay_018128_12 euxassay_018128_13 euxassay_018128_14
EMAGE:9206 EMAGE:9206 EMAGE:9206 EMAGE:9206 EMAGE:9206
euxassay_018128_15 euxassay_018128_16 euxassay_018128_17 euxassay_018128_18 euxassay_018128_19
EMAGE:9206 EMAGE:9206 EMAGE:9206 EMAGE:9206 EMAGE:9206
euxassay_018128_20 euxassay_018128_21 euxassay_018128_22 euxassay_018128_23 euxassay_018128_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9206Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9206_wholemount_strong.wlz
9206_wholemount_moderate.wlz
9206_wholemount_weak.wlz
9206_wholemount_possible.wlz
9206_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9206_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T50069
Entity Detected:Ap2b1, adaptor-related protein complex 2, beta 1 subunit ( MGI:1919020)
Sequence:sense strand is shown

>T50069
GGGTCCAGTCAGCCTGTAATCGGTGCAAGCCAAGAACTCTTAACTGGAAGACGTTGTACTGTTGTGTAGA
GCCTGAACCCAAACCCTGCGGTACCCACCCCGGTAGTGGCCAGTCATCTTGTGCTGACATTAGCATTCAC
CCTGTTGGATAGGTTAGCTTCCCGAGACATCTCCTTCCACCATTCCCCACTTCTGCCACCTGCTGCTCTT
CTCTGTCCTTAGTTGTGAGCTTCTCCATGCTGTGCCAATGGCTAGCCTTTTCTACACCCTCTTTTGAGTG
TAGTTTGATATTTTGTAATCAAAAGCTCATTTCACAAGCAGAAAAAGGCGACAAG
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:GGGTCCAGTCAGCCTGTAAT; Reverse Primer - name:unspecified, sequence:CTTGTCGCCTTTTTCTGCTT. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9207 same embryo
 EMAGE:9205 same embryo
 EMAGE:9203 same embryo
 EMAGE:9204 same embryo
 EurExpress:euxassay_018128 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS