Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:953

Pou5f1 POU domain, class 5, transcription factor 1 ( MGI:101893)
TS11 (7.75 dpc)
in situ hybridisation

Data Images
EMAGE:953 EMAGE:953
Figure 2G of Rathjen et al., 2002 [PMID:12015293] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright. Figure 2F of Rathjen et al., 2002 [PMID:12015293] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Image F is a brightfield image of the section shown in Image G. Image annotations: black arrow - neural ectoderm; outlined arrow - mesoderm.
Expression Pattern Description
Spatial Annotation:
EMAGE:953EMAGE:953Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
953_voxel_strong_3D_1.wlz
953_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:953_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
neural ectoderm
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:2179322
Entity Detected:Pou5f1, POU domain, class 5, transcription factor 1 ( MGI:101893)
Sequence:sense strand is shown

>MGI:2179322
GCCTTGCAGCTCAGCCTTAAGAACATGTGTAAGCTGCGGCCCCTGCTGGAGAAGTGGGTGGAGGAAGCCG
ACAACAATGAGAACCTTCAGGAGATATGCAAATCGGAGACCCTGGTGCAGGCCCGGAAGAGAAAGCGAAC
TAGCATTGAGAACCGTGTGAGGTGGAGTCTGGAGACCATGTTTCTGAAGTGCCCGAAGCCCTCCCTACAG
CAGATCACTCACATCGCCAATCAGCTTGGGCTAGAGAAGGATGTGGTTCGAGTATGGTTCTGTAACCGGC
GCCAGAAGGGCAAAAGATCAAGTATTGAGTATTCCCAACGAGAAGAGTATGAGGCTACAGGGACACCTTT
CCCAGGGGGGGCTGTATCCTTTCCTCTGCCCCCAGGTCCCCACTTTGGCACCCCAGGCTATGGAAGCCCC
CACTTCACCACACTCTACTCAGTCCCTTTTCCTGAGGGCGAGG
nt 491 - nt 953 of X52437.1
Notes:The Pou5f1 (Oct4) probe used in this study by Rathjen et al., 2002 [PMID:12015293] is described as follows, "Antisense Oct4 probe was synthesised by T3 RNA polymerase as run-off by transcripts from Bluescript containing a 462 bp StuI Oct4 cDNA fragment (Sch�ler et al., 1990 [PMID:1690859] ) linearised with HindIII".
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:7.75 dpc
Theiler Stage:TS11
Mutations:none (wild-type)
Preparation:section
Procedures
Staining procedure:autoradiography
General Information
Authors:Rathjen et al., 2002 [PMID:12015293] Indexed by GXD, Spatially Mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:12015293] Rathjen J, Haines BP, Hudson KM, Nesci A, Dunn S, Rathjen PD 2002 Directed differentiation of pluripotent cells to neural lineages: homogeneous formation and differentiation of a neurectoderm population. Development (129):2649-61
 [ doi:10.1038/344435a0] [ PMID:1690859] Scholer HR, Ruppert S, Suzuki N, Chowdhury K, Gruss P 1990 New type of POU domain in germ line-specific protein Oct-4. Nature (344):435-9
Links:MGI:2179345 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI