Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:955

Slc2a1 solute carrier family 2 (facilitated glucose transporter), member 1 ( MGI:95755)
TS12 (8.5 dpc)
in situ hybridisation

Data Images
EMAGE:955 EMAGE:955
Figure 4A of Smith and Gridley, 1992 [PMID:1289053] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright. Figure 4B of Smith and Gridley, 1992 [PMID:1289053] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: two stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Image B is a higher magnification of the section shown in image A. Image annotations: a - amnion; ne - neuroepithelium; nt - neural tube; s - somite; se - non-neural surface ectoderm; so - somatopleure; sp - splanchnopleure; ys - yolk sac.
Expression Pattern Description
Spatial Annotation:
EMAGE:955EMAGE:955Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
955_voxel_strong_3D_1.wlz
955_voxel_moderate_3D_1.wlz
955_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:955_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
extraembryonic component
detected detected
High levels of expression are observed in the amnion and yolk sac.
embryo
detected detected
surface ectoderm
strong strong
future spinal cord
strong strong
head somite
not detected not detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:8892
Entity Detected:Slc2a1, solute carrier family 2 (facilitated glucose transporter), member 1 ( MGI:95755)
Sequence:sense strand is shown

>MGI:8892
GGTCTACGTGGAGCCCTAGGCACACTGCACCAGCTGGGAATCGTCGTTGGCATCCTTATTGCCCAGGTGT
TTGGCTTAGACTCCATCATGGGCAATGCAGACTTGTGGCCTCTGCTGCTCAGTGTCATCTTCATCCCAGC
CCTGCTACAGTGTATCCTGTTGCCCTTCTGCCCCGAGAGCCCCCGCTTCCTGCTCATCAATCGTAACGAG
GAGAACCGGGCCAAGAGTGTGCTGAAGAAGCTTCGAGGGACAGCCGATGTG
nt 1 - nt 261 of X69697.1
Notes:The Slc2a1 (Glut1) probe used in this study by Smith & Gridley is described as being "identical to the mouse Glut-1 cDNA (Reed et al., 1990 [PMID:2190533] )." The probe was hydrolysed to approx 100 bases in length.
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Strain:C57BL/6
Age:8.5 dpc
Theiler Stage:TS12
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:4% paraformaldehyde
Embedding:paraffin
Staining procedure:autoradiography
General Information
Authors:Smith & Gridley, 1992 [PMID:1289053] Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:1289053] Smith DE, Gridley T 1992 Differential screening of a PCR-generated mouse embryo cDNA library: glucose transporters are differentially expressed in early postimplantation mouse embryos. Development (116):555-61
 [ doi:10.1016/0003-9861(90)90490-P] [ PMID:2190533] Reed BC, Shade D, Alperovich F, Vang M 1990 3T3-L1 adipocyte glucose transporter (HepG2 class): sequence and regulation of protein and mRNA expression by insulin, differentiation, and glucose starvation. Arch Biochem Biophys (279):261-74
Links:MGI:1342820 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI