Type: | in situ hybridisation probe |
Identifier: | MGI:1328204 |
Entity Detected: | Pax6, paired box gene 6 ( MGI:97490) |
Sequence: | sense strand is shown
>MGI:1328204
GTGCATTTGCATGTTGCGGAGTGATTAGTGGGTTTGAAAAGCGAACCGTGGCTCGGCCTCATTTCCCGCT
CTGGTTCAGGCGCAGGAGGAAGTGTTTTGCTGGAGGATGATGACAGAGGTCAGGCTTCGCTAATGGGCCA
GTGAGGAGCGGTGGAGGCGAGCCGGGCGCCGGCACACACACATTAACACACTTGAGCCATCA
|
| nt 3884 - nt 4085 of AF098640.1 |
Notes: | The Pax6 probe used in this study by Xu et al., 1999 [PMID:9847251] specifically detects a product transcribed from the P1 promoter and is described as: "201bp of exon 1 (from nucleotide position +1 to +201, as shown in Fig. 1D)." The GenBank accession number for the promoter is given as AF008211 (which has been subsequently replaced by AF098640). |
Chemistry: | DNA |
Strand: | antisense |
Label: | S35 |