Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9711

Actn2 actinin alpha 2 ( MGI:109192)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9711 EMAGE:9711 EMAGE:9711 EMAGE:9711 EMAGE:9711
"Pseudo-wholemount" of euxassay_018448. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_018448_01 euxassay_018448_02 euxassay_018448_03 euxassay_018448_04
EMAGE:9711 EMAGE:9711 EMAGE:9711 EMAGE:9711 EMAGE:9711
euxassay_018448_05 euxassay_018448_06 euxassay_018448_07 euxassay_018448_08 euxassay_018448_09
EMAGE:9711 EMAGE:9711 EMAGE:9711 EMAGE:9711 EMAGE:9711
euxassay_018448_10 euxassay_018448_11 euxassay_018448_12 euxassay_018448_13 euxassay_018448_14
EMAGE:9711 EMAGE:9711 EMAGE:9711 EMAGE:9711 EMAGE:9711
euxassay_018448_15 euxassay_018448_16 euxassay_018448_17 euxassay_018448_18 euxassay_018448_19
EMAGE:9711 EMAGE:9711 EMAGE:9711 EMAGE:9711 EMAGE:9711
euxassay_018448_20 euxassay_018448_21 euxassay_018448_22 euxassay_018448_23 euxassay_018448_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9711Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9711_wholemount_strong.wlz
9711_wholemount_moderate.wlz
9711_wholemount_weak.wlz
9711_wholemount_possible.wlz
9711_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9711_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T50060
Entity Detected:Actn2, actinin alpha 2 ( MGI:109192)
Sequence:sense strand is shown

>T50060
GGCAGAGCAGGTCATCGCCTCCTTCCGGATTCTGGCTTCTGATAAGCCTTACATCTTGGCAGAGGAGCTT
CGTCGAGAGCTGCCTCCGGATCAGGCCCAGTACTGCATCAAGAGAATGCCCCCATACTCAGGCCCGGGCA
GTGTCCCCGGGGCCCTGGACTACACTGCCTTCTCCTCTGCCCTC
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:unspecified; Reverse Primer - name:unspecified, sequence:unspecified. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9708 same embryo
 EMAGE:9710 same embryo
 EMAGE:9707 same embryo
 EMAGE:9709 same embryo
 EurExpress:euxassay_018448 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS