Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9889

Slc26a2 solute carrier family 26 (sulfate transporter), member 2 ( MGI:892977)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9889 EMAGE:9889 EMAGE:9889 EMAGE:9889 EMAGE:9889
"Pseudo-wholemount" of euxassay_008150. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008150_01 euxassay_008150_02 euxassay_008150_03 euxassay_008150_04
EMAGE:9889 EMAGE:9889 EMAGE:9889 EMAGE:9889 EMAGE:9889
euxassay_008150_05 euxassay_008150_06 euxassay_008150_07 euxassay_008150_08 euxassay_008150_09
EMAGE:9889 EMAGE:9889 EMAGE:9889 EMAGE:9889 EMAGE:9889
euxassay_008150_10 euxassay_008150_11 euxassay_008150_12 euxassay_008150_13 euxassay_008150_14
EMAGE:9889 EMAGE:9889 EMAGE:9889 EMAGE:9889 EMAGE:9889
euxassay_008150_15 euxassay_008150_16 euxassay_008150_17 euxassay_008150_18 euxassay_008150_19
EMAGE:9889 EMAGE:9889 EMAGE:9889 EMAGE:9889 EMAGE:9889
euxassay_008150_20 euxassay_008150_21 euxassay_008150_22 euxassay_008150_23 euxassay_008150_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9889Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9889_wholemount_strong.wlz
9889_wholemount_moderate.wlz
9889_wholemount_weak.wlz
9889_wholemount_possible.wlz
9889_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9889_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 21 22 23 24
hindlimb digit 1 metatarsal
weak weak
regionalweak expression: see section 02 22
hindlimb digit 2 metatarsal
weak weak
regionalweak expression: see section 02 22 23
hindlimb digit 3 metatarsal
weak weak
regionalweak expression: see section 02 22 23
hindlimb digit 4 metatarsal
weak weak
regionalweak expression: see section 22 23
hindlimb digit 5 metatarsal
weak weak
regionalweak expression: see section 22
tarsus
moderate moderate
regionalmoderate expression: see section 02 weak expression: see section 23
fibula
weak weak
regionalweak expression: see section 01 24
tibia
weak weak
regionalweak expression: see section 01 24
otic capsule
strong strong
regionalstrong expression: see section 15 16 17
nasal septum
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15
stomach
strong strong
regionalstrong expression: see section 08 09 10 moderate expression: see section 06 07
mandible
strong strong
regionalstrong expression: see section 11 12 13 weak expression: see section 10
thyroid cartilage
moderate moderate
regionalmoderate expression: see section 10 11 12 13
trachea
weak weak
regionalweak expression: see section 11 12
axial skeleton cervical region
strong strong
regionalstrong expression: see section 07 08 09 moderate expression: see section 15 16 17
axial skeleton lumbar region
strong strong
regionalstrong expression: see section 10 11 13 moderate expression: see section 14 15
axial skeleton sacral region
strong strong
regionalstrong expression: see section 12 13 moderate expression: see section 14 15
axial skeleton thoracic region
strong strong
regionalstrong expression: see section 10 moderate expression: see section 14 15 17
basioccipital bone
strong strong
regionalstrong expression: see section 24
basisphenoid bone
strong strong
regionalstrong expression: see section 23 24
exoccipital bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 19 21 22 23 24
temporal bone petrous part
strong strong
regionalstrong expression: see section 01 02 03 04 19 21 22 23 24
orbito-sphenoid
strong strong
regionalstrong expression: see section 05 06 07 17 18 19 24
viscerocranium
strong strong
regionalExpression in the turbinate bone.
clavicle
strong strong
regionalstrong expression: see section 09 10 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T52
Entity Detected:Slc26a2, solute carrier family 26 (sulfate transporter), member 2 ( MGI:892977)
Sequence:sense strand is shown

>T52
TTNCCTTGGCCAGAGGAGAATATTGCAAAAAGGAAGAGGAAACCCTTCTCTTCTACAGTCTGTCTGAAGC
AGTAGCCTTTGCAGAAGACTCTCAGAATCAGAAAGGGGTGTGTGTTGTCAACGGTCTGAGTCTCTCTGGT
GACTGAGAAAGTTAATCTGCATCTTCCTGGTAACTGGGCAAGTTAATAAAAGGAAGAATAGTGTCTTGCC
TGTTTCAATGTGGAACGTTTTCTACTGTGAAAGGAGAAAGCCATGCACACTTGAAATAGTTCTTTGAAGC
TAGCCTTTCGATAGTCTCATGAGCTTTTGGTTGGGTAGAATCAAAAAGAAGTAAATGTTATGGCTTCCGG
CTTATGCAGATAGCATTCTTGGGGTACAGTATAAATGGAATGGAACTGTAAAGCAGCCCCCAACTTAAGT
GCCTTACTTTAGGAACTATATATCTGAACTCTGTCCTTCAGGATGCAGAGCGAGGTAACGCCGGGCTTTG
CCTGACACACACTGCAGCTCTAGAGAGGGGACGAAGAAAGGAGGCAGCGCTGC
Notes:The probe template was PCR amplified from IMAGE:1080807 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1080807 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4828165 same experiment
 EurExpress:euxassay_008150 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS