Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9909

Rimkla ribosomal modification protein rimK-like family member A ( MGI:3040686)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9909 EMAGE:9909 EMAGE:9909 EMAGE:9909 EMAGE:9909
"Pseudo-wholemount" of euxassay_008155. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008155_01 euxassay_008155_02 euxassay_008155_03 euxassay_008155_04
EMAGE:9909 EMAGE:9909 EMAGE:9909 EMAGE:9909 EMAGE:9909
euxassay_008155_05 euxassay_008155_06 euxassay_008155_07 euxassay_008155_08 euxassay_008155_09
EMAGE:9909 EMAGE:9909 EMAGE:9909 EMAGE:9909 EMAGE:9909
euxassay_008155_10 euxassay_008155_11 euxassay_008155_12 euxassay_008155_13 euxassay_008155_14
EMAGE:9909 EMAGE:9909 EMAGE:9909 EMAGE:9909 EMAGE:9909
euxassay_008155_15 euxassay_008155_16 euxassay_008155_17 euxassay_008155_18 euxassay_008155_19
EMAGE:9909 EMAGE:9909 EMAGE:9909
euxassay_008155_20 euxassay_008155_21 euxassay_008155_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9909Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9909_wholemount_strong.wlz
9909_wholemount_moderate.wlz
9909_wholemount_weak.wlz
9909_wholemount_possible.wlz
9909_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9909_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 04 16
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 15 16 17 18 19 20
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 05 15
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 04 16
ventral grey horn
moderate moderate
regionalmoderate expression: see section 08 12 weak expression: see section 09
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 13 14 weak expression: see section 04 05 06 07
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T64
Entity Detected:Rimkla, ribosomal modification protein rimK-like family member A ( MGI:3040686)
Sequence:sense strand is shown

>T64
CTTTCTAGGTGGTGTGGGTGTCAAGTGCCCACTGACCGAGCAAGGCAAGCAGCTGGCTATCCAGGTGTCC
AACATCCTGGGCATGGATTTCTGTGGCATCGACCTTCTTATCATGGATGACGGCTCCTTCACGGTGTGTG
AGGCCAACGCCAATGTCGGCTTCCTGGCCTTCGACCAGGCATGCAACTTAGATGTGGGGGCAATCATTGC
AGACTATGCTATGTCCCTGCTGCCAAACAGGCAGACTGGGAAGATGGCCATCCTCCCGGGACTGGCAAGT
CCCAGGGAGAAGAACGAGCCAAATGGTTGCGTTTCAGCTCAGGGAGTTGCAGAGAGTGTCTATGCCATCA
CCAATGGGTCTACCTCTAGTGAGAGTGAGCCTGAACTGGGAGAGGCCCGGGATTCCTTAGTAAAAACAAT
GGGGGCCCCGCCTGCGCATGTTGCCCAAGCCTGGTTACAGCATTAACAGGATTGCGTCACGATTCCAGTG
AATTCCTGCTTTCTTGGCAGCA
Notes:The probe template was PCR amplified from IMAGE:1123503 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1123503 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9908 same embryo
 EMAGE:9907 same embryo
 EurExpress:euxassay_008155 same experiment
 MGI:4827744 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS