Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9933

Rdm1 RAD52 motif 1 ( MGI:1913849)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9933 EMAGE:9933 EMAGE:9933 EMAGE:9933 EMAGE:9933
"Pseudo-wholemount" of euxassay_008185. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008185_01 euxassay_008185_02 euxassay_008185_03 euxassay_008185_04
EMAGE:9933 EMAGE:9933 EMAGE:9933 EMAGE:9933 EMAGE:9933
euxassay_008185_05 euxassay_008185_06 euxassay_008185_07 euxassay_008185_08 euxassay_008185_09
EMAGE:9933 EMAGE:9933 EMAGE:9933 EMAGE:9933 EMAGE:9933
euxassay_008185_10 euxassay_008185_11 euxassay_008185_12 euxassay_008185_13 euxassay_008185_14
EMAGE:9933 EMAGE:9933 EMAGE:9933 EMAGE:9933 EMAGE:9933
euxassay_008185_15 euxassay_008185_16 euxassay_008185_17 euxassay_008185_18 euxassay_008185_19
EMAGE:9933 EMAGE:9933 EMAGE:9933 EMAGE:9933
euxassay_008185_20 euxassay_008185_21 euxassay_008185_22 euxassay_008185_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9933Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9933_wholemount_strong.wlz
9933_wholemount_moderate.wlz
9933_wholemount_weak.wlz
9933_wholemount_possible.wlz
9933_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9933_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 11 weak expression: see section 16
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 11 12 14 15 weak expression: see section 03 04 05 06 07 08 09 10 16 17 18 19 20 21 22 23
testis
moderate moderate
regionalmoderate expression: see section 07 08 weak expression: see section 09 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T211
Entity Detected:Rdm1, RAD52 motif 1 ( MGI:1913849)
Sequence:sense strand is shown

>T211
CTCTTTCGTAGTTCCCACCCAGAGCGACAAAGTTTTGTTGGTGTGGGATTTGAGCACTGGGCCCCCAGCC
GAAGCCTTAAGTCATTCTCTGTTCACAGTGTTCTCTCAGTTTGGCCTTCTGTATTCAGTCCGAGTCTTCC
CGAACGCTGCAGTGGCTCGTCCTGGTTTCTACGCCATCATCAAGTTTTACTCCTCGCGGGACGCACAGAG
AGCCCAGAAGGCTTGCGACGGGAAGCCCCTTTTTCAGACCTCACCAGTGAAGGTTCGTCTTGGCACCAGA
CACAAGGCACTGCAACATCAGGCCTTTGCCCTAAACAGCTCACGATGCCAGGAACTGGCCAATTACTACT
TTGGCTTCAGTGGATGGTCGAAAAGGATCATCAAGCTGCAGGAGCTCTCCGGACTGGAGGATGCAGCTCT
CGCTGTGCCCATGCAGAAGGGGAGCCCCCAGTTCCTCTGCGCTGTAGAGGTGGTGCTGCCCCCCTACGGA
TGCAGGAGCCCTGGGGTTGGC
Notes:The probe template was PCR amplified from IMAGE:2648941 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2648941 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9936 same embryo
 EMAGE:9932 same embryo
 EMAGE:9934 same embryo
 EMAGE:9935 same embryo
 EurExpress:euxassay_008185 same experiment
 MGI:4827676 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS