Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9995

Fyttd1 forty-two-three domain containing 1 ( MGI:1917955)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9995 EMAGE:9995 EMAGE:9995 EMAGE:9995 EMAGE:9995
"Pseudo-wholemount" of euxassay_000220. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000220_01 euxassay_000220_02 euxassay_000220_03 euxassay_000220_04
EMAGE:9995 EMAGE:9995 EMAGE:9995 EMAGE:9995 EMAGE:9995
euxassay_000220_05 euxassay_000220_06 euxassay_000220_07 euxassay_000220_08 euxassay_000220_09
EMAGE:9995 EMAGE:9995 EMAGE:9995 EMAGE:9995 EMAGE:9995
euxassay_000220_10 euxassay_000220_11 euxassay_000220_12 euxassay_000220_13 euxassay_000220_14
EMAGE:9995 EMAGE:9995 EMAGE:9995 EMAGE:9995 EMAGE:9995
euxassay_000220_15 euxassay_000220_16 euxassay_000220_17 euxassay_000220_18 euxassay_000220_19
EMAGE:9995 EMAGE:9995 EMAGE:9995 EMAGE:9995 EMAGE:9995
euxassay_000220_20 euxassay_000220_21 euxassay_000220_22 euxassay_000220_23 euxassay_000220_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9995Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9995_wholemount_strong.wlz
9995_wholemount_moderate.wlz
9995_wholemount_weak.wlz
9995_wholemount_possible.wlz
9995_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9995_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium epithelium
strong strong
homogeneousstrong expression: see section 02 06 10 11 12 13 20 21
central nervous system
strong strong
single cellstrong expression: see section 01 02 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa epidermal component
strong strong
homogeneousstrong expression: see section 01 09 10 19 20 21
nasal cavity olfactory epithelium
strong strong
homogeneousstrong expression: see section 02 07 08 moderate expression: see section 09 10 11 13 14 15 16
vomeronasal organ epithelium
strong strong
homogeneousstrong expression: see section 07 moderate expression: see section 09 10
palatal shelf mesenchyme
strong strong
regionalstrong expression: see section 04 20 21
liver
moderate moderate
homogeneousmoderate expression: see section 11 12 13 14 16 18 19 20 21 22 23 24 weak expression: see section 01 02 04 05 06 07 08 09 10 15 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T425
Entity Detected:Fyttd1, forty-two-three domain containing 1 ( MGI:1917955)
Sequence:sense strand is shown

>T425
GCGTGAGTGGGAGGCGGCGGGCCTGCGACTCTGGCCTTCCCGGCTGACTGCTCCGACGCCGCAACCCCAG
TCATGAACCGGTTTGGCACCCGGTTGGTGGGAGCCACGGCGACCCCGCCGCCGCCACCGAAAGCACGAAG
CAATGAGAACCTGGACAAAATCGATATGTCCCTGGATGATATTATCAAACTGAATAGAAAGGAGGGAAAG
AAGCAAAACTTTCCAAGACTAAATAGGAGACTCCAGCAAAGTGGTACCCGGCAATTCAGGATGAGAGTAC
GGTGGGGAATCCAGCAGAATTCTGGTTTTGGTAAAACTAGTTTGAGCCGTAGAGGAAGAGTATTGCCTGG
AAAAAGACGTCCTTATGGAGTTATCACCGGCCTTGCAGCCAGGAAAGCAACTGGGATTCGAAAAGGAATA
AGTCCTATGAATCGTCCACCTCTAAGTGACAAGAATATAGAACGATATTTTCCAG
Notes:The probe template was PCR amplified from IMAGE:3158224 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3158224 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9996 same embryo
 EMAGE:9997 same embryo
 EurExpress:euxassay_000220 same experiment
 MGI:4824952 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS