Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10026

Sgcb sarcoglycan, beta (dystrophin-associated glycoprotein) ( MGI:1346523)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10026 EMAGE:10026 EMAGE:10026 EMAGE:10026 EMAGE:10026
"Pseudo-wholemount" of euxassay_000202. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000202_01 euxassay_000202_02 euxassay_000202_03 euxassay_000202_04
EMAGE:10026 EMAGE:10026 EMAGE:10026 EMAGE:10026 EMAGE:10026
euxassay_000202_05 euxassay_000202_06 euxassay_000202_07 euxassay_000202_08 euxassay_000202_09
EMAGE:10026 EMAGE:10026 EMAGE:10026 EMAGE:10026 EMAGE:10026
euxassay_000202_10 euxassay_000202_11 euxassay_000202_12 euxassay_000202_13 euxassay_000202_14
EMAGE:10026 EMAGE:10026 EMAGE:10026 EMAGE:10026 EMAGE:10026
euxassay_000202_15 euxassay_000202_16 euxassay_000202_17 euxassay_000202_18 euxassay_000202_19
EMAGE:10026 EMAGE:10026 EMAGE:10026 EMAGE:10026 EMAGE:10026
euxassay_000202_20 euxassay_000202_21 euxassay_000202_22 euxassay_000202_23 euxassay_000202_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10026Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10026_wholemount_strong.wlz
10026_wholemount_moderate.wlz
10026_wholemount_weak.wlz
10026_wholemount_possible.wlz
10026_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10026_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
integumental system muscle
strong strong
single cellstrong expression: see section 01 02 03 04 05 06 07 08 11 12 13 17 18 19 20 21 22 23 24
vertebral axis musculature
strong strong
single cellstrong expression: see section 01 02 03 04 05 06 07 08 11 12 13 17 18 20 21 22 23 24
medulla oblongata basal plate mantle layer
strong strong
single cellstrong expression: see section 11 17 18
pons mantle layer
strong strong
regionalstrong expression: see section 08 19
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 08 20
trigeminal v ganglion
strong strong
single cellstrong expression: see section 04 05 06 07 08 20 21 22 23 24
vagus x ganglion
strong strong
single cellstrong expression: see section 11 20
ventral grey horn
strong strong
single cellstrong expression: see section 12 13 17
sympathetic ganglion
strong strong
single cellstrong expression: see section 12
cervico-thoracic ganglion
strong strong
single cellstrong expression: see section 17
thoracic ganglion
strong strong
single cellstrong expression: see section 13 17
peripheral nerve trunk
strong strong
single cellstrong expression: see section 13
dorsal root ganglion
strong strong
single cellstrong expression: see section 18 19
tongue muscle
strong strong
single cellstrong expression: see section 12 13 17 18
extraembryonic component
strong strong
single cellstrong expression: see section 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T273
Entity Detected:Sgcb, sarcoglycan, beta (dystrophin-associated glycoprotein) ( MGI:1346523)
Sequence:sense strand is shown

>T273
CGGGAGAAGGCTGTGGAGCGGAGGAATGTTAACAAAGAGCACAACAGCAATTTCAAAGCTGGATATATCC
CCATCGATGAGGACCGGCTCCATAAGACTGGGCTGAGGGGGCGAAAGGGCAACTTAGCCATCTGCGTGAT
CGTCCTCCTGTTTATCCTGGCCGTCATCAATCTACTCATTACACTTGTCATCTGGGCGGTGATCCGCATT
GGGCCAAATGGGTGTGATAGCATGGAGTTCCACGAGAGCGGTCTGCTGAGGTTCAAGCAAGTGTCTGACA
TGGGCGTCATCCACCCGCTTTATAAGAGCACGGTGGGAGGACGGCGGAATGAAAACCTGGTCATCACTGG
CAACAACCAGCCAATTGTCTTCCAGCAAGGGACGACCAAGCTGAGTGTTGAAAAGAACAAGACCTCCATC
ACCAGCGACATCGGGATGCAGTTTTTTGACCCAAGGACACACAATATCCTGTTCAGCACGGACTATGAGA
CGCA
Notes:The probe template was PCR amplified from IMAGE:2655192 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2655192 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10025 same embryo
 EurExpress:euxassay_000202 same experiment
 MGI:4828020 same experiment
 EMAGE:31506 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS