Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10028

Tmem59 transmembrane protein 59 ( MGI:1929278)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10028 EMAGE:10028 EMAGE:10028 EMAGE:10028 EMAGE:10028
"Pseudo-wholemount" of euxassay_008205. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008205_04 euxassay_008205_05 euxassay_008205_06 euxassay_008205_07
EMAGE:10028 EMAGE:10028 EMAGE:10028 EMAGE:10028 EMAGE:10028
euxassay_008205_08 euxassay_008205_09 euxassay_008205_10 euxassay_008205_11 euxassay_008205_12
EMAGE:10028 EMAGE:10028 EMAGE:10028 EMAGE:10028 EMAGE:10028
euxassay_008205_13 euxassay_008205_14 euxassay_008205_15 euxassay_008205_16 euxassay_008205_17
EMAGE:10028 EMAGE:10028 EMAGE:10028 EMAGE:10028 EMAGE:10028
euxassay_008205_18 euxassay_008205_19 euxassay_008205_20 euxassay_008205_21 euxassay_008205_22
EMAGE:10028
euxassay_008205_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10028Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10028_wholemount_strong.wlz
10028_wholemount_moderate.wlz
10028_wholemount_weak.wlz
10028_wholemount_possible.wlz
10028_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10028_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 19 20 21 22 23
femur
strong strong
regionalstrong expression: see section 04 05 22 23
pituitary gland
strong strong
regionalstrong expression: see section 13 14 15
medulla oblongata floor plate
moderate moderate
regionalmoderate expression: see section 12 13
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 16 17 18
metencephalon floor plate
moderate moderate
regionalmoderate expression: see section 12 13
spinal cord floor plate
moderate moderate
regionalmoderate expression: see section 12 13
basal columns
moderate moderate
regionalmoderate expression: see section 13 14 15 16
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 12 16 20 weak expression: see section 11 19
stomach
strong strong
regionalstrong expression: see section 04 05 06
mandible
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 17 18 19 20 21 22 23
lower jaw alveolar sulcus
strong strong
regionalstrong expression: see section 12 13 16 18
maxilla
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 17 18 19 20 21 22 23
upper jaw alveolar sulcus
strong strong
regionalstrong expression: see section 12 13 16 17 18
axial skeleton
strong strong
regionalstrong expression: see section 07 08 09 10 17 18 19
orbito-sphenoid
strong strong
regionalstrong expression: see section 04 05 23
clavicle
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T315
Entity Detected:Tmem59, transmembrane protein 59 ( MGI:1929278)
Sequence:sense strand is shown

>T315
CAGATGAGAAACTCACAAGCACACAGGAACTACCTTGAAGAGGAAGAAAGCGATGGCTTTTTAAGATGTC
TATCTCTTAACTCTGGATGGATTTTAACCACAACCCTTGTCCTCTCGGTGATGGTGTTGCTCTGGATCTG
TTGTGCAGCTGTTGCTACAGCTGTAGAACAGTATGTTCCCCCTGAGAAGCTGAGTATCTATGGTGACTTG
GAATTTATGAATGAACAAAAGCTGAGCAGATACCCAGCTCCTTCTCTTGTGATTGTTAGGTCTCAGACTG
AAGAACATGAGGAGGCAGGGCCCCTGCCCACCAAGGTGAACCTTGCTCACTCAGAAATCTAAGCTTTTTA
AAAGAGTCGTGGACACATAAATTTCCATTCCTCATAGAGCTTTTTAAGATGGTTTCATTGGACATAGGCC
TTAAGAAATCACTATAAAATGCAAATAAAGTTACCAAACTCTGTGAAGACTTTATTTGCTGTGACTTTAC
CTGTATTTTTCTAGTCATTTAAGATGG
Notes:The probe template was PCR amplified from IMAGE:3153695 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3153695 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10029 same embryo
 EMAGE:10031 same embryo
 EMAGE:10030 same embryo
 EurExpress:euxassay_008205 same experiment
 MGI:4828810 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS