EMAGE mouse gene expression spatial database

EMAGE:10041

C230052I12Rik RIKEN cDNA C230052I12 gene ( MGI:2142208)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_008200. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_008200_01	euxassay_008200_02	euxassay_008200_03	euxassay_008200_04

euxassay_008200_05	euxassay_008200_06	euxassay_008200_07	euxassay_008200_08	euxassay_008200_09

euxassay_008200_10	euxassay_008200_11	euxassay_008200_12	euxassay_008200_13	euxassay_008200_14

euxassay_008200_15	euxassay_008200_16	euxassay_008200_17	euxassay_008200_18	euxassay_008200_19

euxassay_008200_20	euxassay_008200_21	euxassay_008200_22	euxassay_008200_23	euxassay_008200_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T380
Entity Detected:	C230052I12Rik, RIKEN cDNA C230052I12 gene ( MGI:2142208)
Sequence:	sense strand is shown >T380 GAGGTCGTGGGGCCCGCGGCAGCACAGCAAATCCACACCTTCTTCACCCAGCCTAAGCGACAGCAGCCCC GCAGCTGACTCTGCCTTCAGACTTCAAACTGCAGCGTCTGGTTTCCATATTTAAAAAGAAGGAAAAGTTC CCCTGTCAATGGCAATGGGCTAAAGACAAGGAGAGGACCGATGAGGCTCGCAGTCACCCTGCCTCGGTGT CTGTCTGGGCAGCCACCTGGTGGGGCTTGGGGGTCGCGGGCGGCACTGGCCACTTTCTGCTAAGATGAAG AGGGTCCCCACGGGGATCATCCAGAGACTCATTCCCAGCCGCAGCCAGCTGGAGCAGATTTGTACAAGAC TCTCTGCCCTGCCTCTGTCACTGAGAGGCCCTGTGAGGGTCCAGCGCTGAGTAGGGAGTGTCCCCGTTAA CCAGTGTCAGGGCCACAGCTCAGGTCTTCTCCACACTCGTCAGGTACCTGTGCTATGGAGTTTCT
Notes:	The probe template was PCR amplified from IMAGE:3156435 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3156435 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:10036 same embryo
	EMAGE:10038 same embryo
	EMAGE:10037 same embryo
	EMAGE:10040 same embryo
	EMAGE:10039 same embryo
	EurExpress:euxassay_008200 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source