EMAGE mouse gene expression spatial database

EMAGE:10055

Cdca5 cell division cycle associated 5 ( MGI:1915099)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_008198. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_008198_01	euxassay_008198_02	euxassay_008198_03	euxassay_008198_04

euxassay_008198_05	euxassay_008198_06	euxassay_008198_07	euxassay_008198_08	euxassay_008198_09

euxassay_008198_10	euxassay_008198_11	euxassay_008198_12	euxassay_008198_13	euxassay_008198_14

euxassay_008198_15	euxassay_008198_16	euxassay_008198_17	euxassay_008198_18	euxassay_008198_19

euxassay_008198_20	euxassay_008198_21	euxassay_008198_22	euxassay_008198_23	euxassay_008198_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T405
Entity Detected:	Cdca5, cell division cycle associated 5 ( MGI:1915099)
Sequence:	sense strand is shown >T405 CGCGGAGAGAGCAGGTGGTTTCACTCTAAGGTCAAGAGGAGGGAGAGAGCAGTCATGAGGGCACACATGG ACCAGATTGAGTCAGAACAACTCCAGCGGTCCCAGTCAGAAAGGCCATCGTCTTGAAGAAGATCGTAGCT CATGCAGTAGAGGTCCCAGATGTCCACACGGTTCGAAGAAGTCCTAGGATCTCTTTTATTTTGGAAAAAG AGAACAACCCTCCGCTCAAGGTACCCACGAAAGAAGACCTCTTCAAGACTTGTAGTGTCCCTGGTACTCC CTCCAGCACCCCCGTGCTGTACACTCAGAATGTTGAGCCTGACTCTGGAGAAGCAGAGCTGGACAGCAGA GACCTGGAAATGTCTCAGAAAGTCAGGCGGTCGTACAGTCGGCTACAGAGCCTTGGTTGTGCCTCAACCT CCACCCCTGGCCGCCGATCCTTCTTTGGCTTTGAGGGACCTGACGACTTGCCTGGAGTCTCACCTGTCGT
Notes:	The probe template was PCR amplified from IMAGE:3157167 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3157167 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:10056 same embryo
	EMAGE:10057 same embryo
	EMAGE:10058 same embryo
	EurExpress:euxassay_008198 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source