Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10098

Cenpo centromere protein O ( MGI:1923800)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10098 EMAGE:10098 EMAGE:10098 EMAGE:10098 EMAGE:10098
"Pseudo-wholemount" of euxassay_000072. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000072_01 euxassay_000072_02 euxassay_000072_03 euxassay_000072_04
EMAGE:10098 EMAGE:10098 EMAGE:10098 EMAGE:10098 EMAGE:10098
euxassay_000072_05 euxassay_000072_06 euxassay_000072_07 euxassay_000072_08 euxassay_000072_09
EMAGE:10098 EMAGE:10098 EMAGE:10098 EMAGE:10098 EMAGE:10098
euxassay_000072_10 euxassay_000072_11 euxassay_000072_12 euxassay_000072_13 euxassay_000072_14
EMAGE:10098 EMAGE:10098 EMAGE:10098 EMAGE:10098 EMAGE:10098
euxassay_000072_15 euxassay_000072_16 euxassay_000072_17 euxassay_000072_18 euxassay_000072_19
EMAGE:10098 EMAGE:10098 EMAGE:10098 EMAGE:10098
euxassay_000072_20 euxassay_000072_21 euxassay_000072_22 euxassay_000072_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10098Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10098_wholemount_strong.wlz
10098_wholemount_moderate.wlz
10098_wholemount_weak.wlz
10098_wholemount_possible.wlz
10098_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10098_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
homogeneousmoderate expression: see section 13 14 15 16 17 18
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 18 19 20 21 22
vibrissa
weak weak
regionalweak expression: see section 01 02 03 04 05 06 19 20 21 23
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata basal plate
moderate moderate
regionalmoderate expression: see section 10 11 18 19
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 21 23
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 08 09 21
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 18 19 20 21 22 23
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 07 22
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 06 07 08 09 10 11 14 15 16 17 18 19
meckel's cartilage
weak weak
regionalweak expression: see section 01 02 03 04 05 06 21 22
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 09 10 11 12 15 16 17
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 19 20
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 09 10 11 14 15
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 19 20
liver lobe
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
renal cortex
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 18 19 20 21 22
testis
moderate moderate
regionalmoderate expression: see section 05 06 07 08 21 22 23
lung
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 16 17 18 19 20 21 22 23
chondrocranium
weak weak
regionalweak expression: see section 01 02 03 04 21 22 23
tail dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 11 12 16 17 18 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1506
Entity Detected:Cenpo, centromere protein O ( MGI:1923800)
Sequence:sense strand is shown

>T1506
GAGGACCCCACAGCAGCTCTTCCCACGAATGTCACTGTGACAAGGCCAGGTGTGGAGGCATCATCCCCTC
CTTGGGAAGAGCACAGAGCATCCCATCAGATGCTCTTCCGTACACAAGCCCCTGCACAAGGTGTTTGCTT
CATTTTCCAAAGAAACCGAAAAGCTGCATTTGAACCTGGTCTCCTGAAAAACTGTTTCTCTATTTGGGGG
ACAGCAGAAATGAACACACTTGTGCTGCCTCCAGTTCAGGACCAGTCAGCAAAAGCTGTTGGGAGAGTGC
TTGCCTGGATGCCACCATGAGAACAGATACCCACGTCATGGGAATGACAGGGAGCTTGCGTGTACACATA
GACAAGTCCGTATCTGTAGGCACTGGGCAGTTGGAACAGTTCTCCAAAGTGGCCGCTTGTTCACTGTTCA
CTCAGCCCAGTGCTCCAGAATATCTCTTCCTCCTGTAAGCACCAGTGCTGACTTGGTTGTATGCATATGT
TCTTGCTGGAATCAGCTAGAATGGGGGTA
Notes:The probe template was PCR amplified from IMAGE:560206 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:560206 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10097 same embryo
 EMAGE:10096 same embryo
 EMAGE:10095 same embryo
 EurExpress:euxassay_000072 same experiment
 MGI:4823809 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS