Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10101

Zfp184 zinc finger protein 184 (Kruppel-like) ( MGI:1922244)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10101 EMAGE:10101 EMAGE:10101 EMAGE:10101 EMAGE:10101
"Pseudo-wholemount" of euxassay_000250. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000250_01 euxassay_000250_02 euxassay_000250_03 euxassay_000250_04
EMAGE:10101 EMAGE:10101 EMAGE:10101 EMAGE:10101 EMAGE:10101
euxassay_000250_05 euxassay_000250_06 euxassay_000250_07 euxassay_000250_08 euxassay_000250_09
EMAGE:10101 EMAGE:10101 EMAGE:10101 EMAGE:10101 EMAGE:10101
euxassay_000250_10 euxassay_000250_11 euxassay_000250_12 euxassay_000250_13 euxassay_000250_14
EMAGE:10101 EMAGE:10101 EMAGE:10101 EMAGE:10101 EMAGE:10101
euxassay_000250_15 euxassay_000250_16 euxassay_000250_17 euxassay_000250_18 euxassay_000250_19
EMAGE:10101 EMAGE:10101 EMAGE:10101 EMAGE:10101 EMAGE:10101
euxassay_000250_20 euxassay_000250_21 euxassay_000250_22 euxassay_000250_23 euxassay_000250_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10101Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10101_wholemount_strong.wlz
10101_wholemount_moderate.wlz
10101_wholemount_weak.wlz
10101_wholemount_possible.wlz
10101_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10101_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 15 16 17 18
vibrissa
moderate moderate
regionalmoderate expression: see section 03 06 21
cerebral cortex mantle layer
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 14 15 16 17 18 19 20 21 22
esophagus
weak weak
regionalweak expression: see section 11 12
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 14
lower jaw molar
moderate moderate
regionalmoderate expression: see section 05 06 19
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 12
upper jaw molar
moderate moderate
regionalmoderate expression: see section 05 06 19
renal cortex
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 18 19 20 21 22
lung
moderate moderate
spottedmoderate expression: see section 03 04 05 06 07 08 09 10 11 14 15 16 17 18 19 20 21 22
trachea
weak weak
regionalweak expression: see section 11 12 13
tail dorsal root ganglion
weak weak
regionalweak expression: see section 05 06 07 08 10 14 15 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1549
Entity Detected:Zfp184, zinc finger protein 184 (Kruppel-like) ( MGI:1922244)
Sequence:sense strand is shown

>T1549
TTTTTTTTTTTTTTGTAGTGCAACTATTTATGAATATAAATATACAAAACTGAGTATAAAACTCCAAGCT
ACCTTTCAGATCATCTCTGAATCTTTCATTTCACCTCATTTACAGAAGAAACTTAAAGCAGCTTGCCACA
ATGTTGTTTTAATAACATACTTGGATCAGAACAGCCCAATGGGCTCTCCATCCCACCATGTGACAGAGAA
AAATTTACTTTAAGGAGTTCCTCCTCCCACTCTGATTCATTTCTATAAAACCAAAGTTAGCAGAGCAACT
ATGTTAATGATGTTCCTACAGCAGCCACAGCAGGGTGCAATCTCTGGTGTTTGGTGAGAGCAGAGTGACA
CTGGAAGGCTTTTTCACAGTCCTCACACCCCAAAAGCTTCTCTCCTGAATGAATCTTCTGATGCTGAGTG
AGGTATGTGCTCTGGCTGAAAGTCTGTGGGCACTCAGAGTTGTAAGGTTTCTCTCCAGTGTGAGTACTCC
GATGTTCAGTCAGGTGCA
Notes:The probe template was PCR amplified from IMAGE:865559 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:865559 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10100 same embryo
 EMAGE:10099 same embryo
 EMAGE:10102 same embryo
 EMAGE:10103 same embryo
 EurExpress:euxassay_000250 same experiment
 MGI:4829293 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS