Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10130

C130073F10Rik RIKEN cDNA C130073F10 gene ( MGI:3045359)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10130 EMAGE:10130 EMAGE:10130 EMAGE:10130 EMAGE:10130
"Pseudo-wholemount" of euxassay_000051. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000051_01 euxassay_000051_02 euxassay_000051_03 euxassay_000051_04
EMAGE:10130 EMAGE:10130 EMAGE:10130 EMAGE:10130 EMAGE:10130
euxassay_000051_05 euxassay_000051_06 euxassay_000051_07 euxassay_000051_08 euxassay_000051_09
EMAGE:10130 EMAGE:10130 EMAGE:10130 EMAGE:10130 EMAGE:10130
euxassay_000051_10 euxassay_000051_11 euxassay_000051_12 euxassay_000051_13 euxassay_000051_14
EMAGE:10130 EMAGE:10130 EMAGE:10130 EMAGE:10130 EMAGE:10130
euxassay_000051_15 euxassay_000051_16 euxassay_000051_17 euxassay_000051_18 euxassay_000051_19
EMAGE:10130 EMAGE:10130 EMAGE:10130 EMAGE:10130 EMAGE:10130
euxassay_000051_20 euxassay_000051_21 euxassay_000051_22 euxassay_000051_23 euxassay_000051_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10130Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10130_wholemount_strong.wlz
10130_wholemount_moderate.wlz
10130_wholemount_weak.wlz
10130_wholemount_possible.wlz
10130_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10130_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
strong strong
regionalstrong expression: see section 18 19 moderate expression: see section 07 08 09 10 17
diencephalon
moderate moderate
regionalmoderate expression: see section 11 12 13 14
vibrissa
strong strong
regionalstrong expression: see section 05 07 20 22 moderate expression: see section 04 06 weak expression: see section 23
telencephalon
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 weak expression: see section 01 02 24
cerebellum
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22
midbrain
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17
spinal cord
moderate moderate
regionalmoderate expression: see section 13
retina
moderate moderate
regionalmoderate expression: see section 01 02 03 weak expression: see section 23 24
midgut
weak weak
regionalweak expression: see section 01 02 03 04 05
liver
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
metanephros
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 05 06 08 09 10 16 17 18 19
lung
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 13 14 15 16 17 18 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1596
Entity Detected:C130073F10Rik, RIKEN cDNA C130073F10 gene ( MGI:3045359)
Sequence:sense strand is shown

>T1596
CTGCTGAATCATGAAGACTTGGCTGTCTCTGCTCTAAAGGACCTCCCCTCAGTGTTTTTCCTACCACTGT
TCAAGGAGGCCTTCACTAAGAGACGACATAAACTTGTGAAGCACCTGGTAGTAACTTGGCCCTACCGCAA
CCTCTACATTGGCCCTCTGAAGCACAGCTTCAATTTGTATAACTTCAAGGGTGTTTACAATGGAGTAGAT
TGGCTGAGTAACCAGAAGGTTTGGCCTAGGAGGTGTAGACTGAAAGAGGTCTATTTGCTGGATGCCAACC
ATGACTTCCTGGTAATAATGAATCCAGGACAGGATCATCTCTGCACACCACAGCCCCAACGAGAGGAGGA
AGATCCCACAACAGTGCAGAGGAAACCAATAACTGTTTATGCTGACTCTGCCTTTATGGCAGATAGTCTC
AAACCCTATCGTGATTTATTGGAGGAGAGTTTCAATGAGAGATTGACTACAATGAGCGTGAATTTTAAGG
AGATGGAACCGCAAAAGAAGGA
Notes:The probe template was PCR amplified from IMAGE:990453 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:990453 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10131 same embryo
 EMAGE:10134 same embryo
 EMAGE:10132 same embryo
 EMAGE:10133 same embryo
 EurExpress:euxassay_000051 same experiment
 MGI:4823532 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS