EMAGE mouse gene expression spatial database

EMAGE:10375

Limch1 LIM and calponin homology domains 1 ( MGI:1924819)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_000505. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_000505_01	euxassay_000505_02	euxassay_000505_03	euxassay_000505_04

euxassay_000505_05	euxassay_000505_06	euxassay_000505_07	euxassay_000505_08	euxassay_000505_09

euxassay_000505_10	euxassay_000505_11	euxassay_000505_12	euxassay_000505_13	euxassay_000505_14

euxassay_000505_15	euxassay_000505_16	euxassay_000505_17	euxassay_000505_18	euxassay_000505_19

euxassay_000505_20	euxassay_000505_21	euxassay_000505_22	euxassay_000505_23	euxassay_000505_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T3655
Entity Detected:	Limch1, LIM and calponin homology domains 1 ( MGI:1924819)
Sequence:	sense strand is shown >T3655 GGCTGCGATGATCATCGAGACCCTGAATCTCTACTTTCACATTCAGTGTTTCAGGTGCGGCATCTGTAAA GGACAGCTCGGAGATGCAGTAAGCGGGACAGACGTCAGGATTCGCAATGGTCTCCTAAACTGTACCGACT GCTACATGCGATCCAGAAGTGCCGGCCAGCCTACAACACTGTGATGAGGTTGGGAGCTTCTGGGCCACTG AGGATTTTTCTACTAAGAGTGTCCCTTGGCAATTGCTTTATTAAACCCCAAGTCCAGGGGATTCTTGGCA TTCACCTAATTTCTGGAAGACTCCCCTACAAGGTGGTATCTGCTCTTTTGTATTGCAGCACAGTGTTTCT GCTTCTGGTTGAAAAGGGGTTACTCTCTTGTCTGGGGAAGAGCAGAAGGGTGCAATAAACCTGTTGTGTT TTAGTGTTTCTAGAAAAAAAAAAAAAAA
Notes:	The probe template was PCR amplified from IMAGE:349545 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:349545 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:10376 same embryo
	EMAGE:10374 same embryo
	EMAGE:10378 same embryo
	EMAGE:10373 same embryo
	EMAGE:10377 same embryo
	EurExpress:euxassay_000505 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source