Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10422

Cntn2 contactin 2 ( MGI:104518)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10422 EMAGE:10422 EMAGE:10422 EMAGE:10422 EMAGE:10422
"Pseudo-wholemount" of euxassay_000546. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000546_01 euxassay_000546_02 euxassay_000546_03 euxassay_000546_04
EMAGE:10422 EMAGE:10422 EMAGE:10422 EMAGE:10422 EMAGE:10422
euxassay_000546_05 euxassay_000546_06 euxassay_000546_07 euxassay_000546_08 euxassay_000546_09
EMAGE:10422 EMAGE:10422 EMAGE:10422 EMAGE:10422 EMAGE:10422
euxassay_000546_10 euxassay_000546_11 euxassay_000546_12 euxassay_000546_13 euxassay_000546_14
EMAGE:10422 EMAGE:10422 EMAGE:10422 EMAGE:10422 EMAGE:10422
euxassay_000546_15 euxassay_000546_16 euxassay_000546_17 euxassay_000546_18 euxassay_000546_19
EMAGE:10422 EMAGE:10422 EMAGE:10422 EMAGE:10422 EMAGE:10422
euxassay_000546_20 euxassay_000546_21 euxassay_000546_22 euxassay_000546_23 euxassay_000546_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10422Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10422_wholemount_strong.wlz
10422_wholemount_moderate.wlz
10422_wholemount_weak.wlz
10422_wholemount_possible.wlz
10422_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10422_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
epithalamus mantle layer
strong strong
gradedstrong expression: see section 08 12
epithalamic recess
strong strong
gradedstrong expression: see section 08 12
hypothalamus
strong strong
regionalstrong expression: see section 10 14
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 10
thalamus
strong strong
regionalstrong expression: see section 09 10 11
thalamus mantle layer
strong strong
regionalstrong expression: see section 09 10 11 14
cerebral cortex mantle layer
strong strong
gradedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
cerebral cortex marginal layer
strong strong
gradedstrong expression: see section 21
telencephalon mantle layer
strong strong
gradedstrong expression: see section 01 03 22
olfactory cortex mantle layer
strong strong
gradedstrong expression: see section 01 02 04 05 06 07 08 09 10 11 12 13 14 15 18
medulla oblongata alar plate mantle layer
strong strong
gradedstrong expression: see section 02 03 04
medulla oblongata basal plate mantle layer
strong strong
gradedstrong expression: see section 02
cerebellum intraventricular portion mantle layer
strong strong
gradedstrong expression: see section 03 04
rest of cerebellum mantle layer
strong strong
gradedstrong expression: see section 03 04
metencephalon rest of alar plate mantle layer
strong strong
gradedstrong expression: see section 01
pons mantle layer
strong strong
gradedstrong expression: see section 01
midbrain mantle layer
strong strong
gradedstrong expression: see section 01 05 06 07 10 11 12 13 14 15 16 17
glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 07 08 18 19
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 16 17 18 19 20 21
vagus x ganglion
strong strong
homogeneousstrong expression: see section 06 07 18 19
vestibulocochlear viii ganglion
strong strong
homogeneousstrong expression: see section 04 06 07 18 19
spinal cord
strong strong
gradedstrong expression: see section 14
spinal cord lateral wall
strong strong
regionalstrong expression: see section 15
spinal cord mantle layer
strong strong
gradedstrong expression: see section 01 14 15
alar columns
strong strong
gradedstrong expression: see section 14
neural retina
strong strong
homogeneousstrong expression: see section 21 22 23
tail dorsal root ganglion
strong strong
homogeneousstrong expression: see section 09 10 11 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3805
Entity Detected:Cntn2, contactin 2 ( MGI:104518)
Sequence:sense strand is shown

>T3805
TGGCCTCGAGCCAGAATTCGGCACGAGGAGTTTTCTGACCAGAGCCCTTCCAGACCTTCCAGCATGGCAG
GTAGACTTTAGTCTTTAGTCAGCTTTTACCTTCCCAGGGCAGTTATATACACAAGACTCAGGGAACTGAA
TTGAGGGGGGCTTGCTGCTGTAACCGCAGCCACGCAGATGCTAAGCAGGATCTTGCCAAGTGGTCCTGGC
TGGCCATGAGCTCACTATGTAGACTAGACTGCCTCAGTCTCCGAATAGCTGTGATTACAGGAATATGCCA
CCTCGACCAGACAGAACTATGCTGTTGTCTTTACAAAATCCATCTGACGGTCTTTGTCCTCCTCTTTGCT
CAATTGCTTTTGACTCAGGATTTGAAGCAATTGAGCGGAGTCAAAATTCAGAAGCCCAAGGCACAGAGAG
GCAGCTATGAACAAGATCGATCCACCTTCGACTTGACTATTGGTCTGCAAGAGAATGCTGGCAAAGTGTT
AAATGGTTGTCCTGGGTGGTTTCCATCTACAGAATGTGAGACAGGAGCCTACAGCAGTATGTTACCAAGC
Notes:The probe template was PCR amplified from IMAGE:402312 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:402312 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10426 same embryo
 EMAGE:10423 same embryo
 EMAGE:10425 same embryo
 EMAGE:10424 same embryo
 EMAGE:10421 same embryo
 EurExpress:euxassay_000546 same experiment
 MGI:4823962 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS