Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10435

Kcnk2 potassium channel, subfamily K, member 2 ( MGI:109366)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10435 EMAGE:10435 EMAGE:10435 EMAGE:10435 EMAGE:10435
"Pseudo-wholemount" of euxassay_000689. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000689_01 euxassay_000689_02 euxassay_000689_03 euxassay_000689_04
EMAGE:10435 EMAGE:10435 EMAGE:10435 EMAGE:10435 EMAGE:10435
euxassay_000689_05 euxassay_000689_06 euxassay_000689_07 euxassay_000689_08 euxassay_000689_09
EMAGE:10435 EMAGE:10435 EMAGE:10435 EMAGE:10435 EMAGE:10435
euxassay_000689_10 euxassay_000689_11 euxassay_000689_12 euxassay_000689_13 euxassay_000689_14
EMAGE:10435 EMAGE:10435 EMAGE:10435 EMAGE:10435 EMAGE:10435
euxassay_000689_15 euxassay_000689_16 euxassay_000689_17 euxassay_000689_18 euxassay_000689_19
EMAGE:10435 EMAGE:10435 EMAGE:10435 EMAGE:10435 EMAGE:10435
euxassay_000689_20 euxassay_000689_21 euxassay_000689_22 euxassay_000689_23 euxassay_000689_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10435Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10435_wholemount_strong.wlz
10435_wholemount_moderate.wlz
10435_wholemount_weak.wlz
10435_wholemount_possible.wlz
10435_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10435_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
limb
weak weak
regionalweak expression: see section 03 04 05 06 21 22 23 24
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 11 13 14
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 12 13
medulla oblongata basal plate ventricular layer
weak weak
regionalweak expression: see section 12 13
pons ventricular layer
weak weak
regionalweak expression: see section 12 13
midbrain ventricular layer
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15
ventral grey horn
weak weak
regionalweak expression: see section 13
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 10 11 12 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2113
Entity Detected:Kcnk2, potassium channel, subfamily K, member 2 ( MGI:109366)
Sequence:sense strand is shown

>T2113
TGGCCTCGAGNCAGATTCGGCACGAGGTTTCTTAAGTGGTTCTTGCCAAACTGGAGGGAGGGGCGATGCC
CTTCAGAAGGGGGCACAGCCCCAGCCAGCCCAGGGTCCCTCTGTGGTCATGACTGGGTGTGAGCACAGAT
GCTGGCCTTGGGATCACTGTGAGTTTTGCACATGGAGAGATACAGACTGCTGGCATAGGTCGTCTCTAAC
AGTAGAGAAAACGCCGATTAGCACAATCTAAATCCCCCGAGTTACTTTTTGTTTAGGATAAGAGAAGGCT
GGTAATTCACTTAATTTAAATTTATATCCTATAATTCTTTTTGGATGTTTCAAGATTCAGAAAAAGTCCA
GTCCCTGCATCTAGCAAACCGCCGCCCTTTCCTCTGTGCCCGTACTTACATCTACTGAACACTGTATATG
TAATTTTTAAATTTTTAAAGCGCAGAAGGAAAATGATTCTTCTACATGTAATCGCAAAACTGATTTCTCC
CTTCTGGGGGAGGCTTGGGCTTACGTGATCATGTGGCATTCAGAGTAAA
Notes:The probe template was PCR amplified from IMAGE:851648 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:851648 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10434 same embryo
 EMAGE:10437 same embryo
 EMAGE:10438 same embryo
 EMAGE:10436 same embryo
 EMAGE:10433 same embryo
 EurExpress:euxassay_000689 same experiment
 MGI:4825724 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS