Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10504

Slc16a7 solute carrier family 16 (monocarboxylic acid transporters), member 7 ( MGI:1330284)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10504 EMAGE:10504 EMAGE:10504 EMAGE:10504 EMAGE:10504
"Pseudo-wholemount" of euxassay_000705. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000705_01 euxassay_000705_02 euxassay_000705_03 euxassay_000705_04
EMAGE:10504 EMAGE:10504 EMAGE:10504 EMAGE:10504 EMAGE:10504
euxassay_000705_05 euxassay_000705_06 euxassay_000705_07 euxassay_000705_08 euxassay_000705_09
EMAGE:10504 EMAGE:10504 EMAGE:10504 EMAGE:10504 EMAGE:10504
euxassay_000705_10 euxassay_000705_11 euxassay_000705_12 euxassay_000705_13 euxassay_000705_14
EMAGE:10504 EMAGE:10504 EMAGE:10504 EMAGE:10504 EMAGE:10504
euxassay_000705_15 euxassay_000705_16 euxassay_000705_17 euxassay_000705_18 euxassay_000705_19
EMAGE:10504 EMAGE:10504 EMAGE:10504
euxassay_000705_20 euxassay_000705_21 euxassay_000705_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10504Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10504_wholemount_strong.wlz
10504_wholemount_moderate.wlz
10504_wholemount_weak.wlz
10504_wholemount_possible.wlz
10504_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10504_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
facial vii ganglion
weak weak
homogeneousweak expression: see section 03 04 19 20
inferior glossopharyngeal ix ganglion
weak weak
homogeneousweak expression: see section 05 06 18
superior glossopharyngeal ix ganglion
weak weak
homogeneousweak expression: see section 18
trigeminal v ganglion
weak weak
homogeneousweak expression: see section 03 04 05 06 07 16 17 18 19 20 21
vagus x ganglion
weak weak
homogeneousweak expression: see section 07 17
vestibulocochlear viii ganglion vestibular component
weak weak
homogeneousweak expression: see section 19
dorsal root ganglion
weak weak
regionalweak expression: see section 06 07 08 12 13 15 16
stomach
weak weak
homogeneousweak expression: see section 01 02 03 04 05 06
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1426
Entity Detected:Slc16a7, solute carrier family 16 (monocarboxylic acid transporters), member 7 ( MGI:1330284)
Sequence:sense strand is shown

>T1426
GGCTGATGCGGCTTCTCTCTCTCTCCAGATAATCTGGAGGCTGCTCTACCTCTCCCTTCATATTGCCTTC
GAATATTGCACGTCAACACAAAGTGGCTAGGCTTAAATATTCTACCCACCACCCAAAGCTGTTAAAGTGT
CATCTGACAACAGGTCACCTTNGTCTCCAGTAGAAGTGCAGAAATGCCATCAGAGCCTTCCGCGCCGCTT
CCACAACCACTTCCTCCCGACGGAGGGTGGGGCTGGGTCGTAGTCTGTGCGTCCTTTATCTCCATTGGAT
TTTCATATGCCTTCCCCAAAGCTGTCACAGTATTCTTCAAAGACATCCAGGAAATATTCAACACCACCTC
CAGTCAGATCGCTTGGATATCGTCCATCATGCTAGCTGTCATGTATGCGGGAGGTCCCATCAGTAGTGTG
TTGGTGAATAACTATGGCAGCCGGCCTGTGGTGATAGTGGGAGGACTATTATGCTGCATTGGAATGATCT
TGGCTTCTTACAGCAACAGCGTGATAGAGCTTTATCTCACCGTTGGCTTCA
Notes:The probe template was PCR amplified from IMAGE:2395246 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2395246 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10502 same embryo
 EMAGE:10505 same embryo
 EMAGE:10503 same embryo
 EMAGE:10501 same embryo
 EurExpress:euxassay_000705 same experiment
 MGI:4828116 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS