Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10560

St3gal4 ST3 beta-galactoside alpha-2,3-sialyltransferase 4 ( MGI:1316743)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10560 EMAGE:10560 EMAGE:10560 EMAGE:10560 EMAGE:10560
"Pseudo-wholemount" of euxassay_000781. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000781_01 euxassay_000781_02 euxassay_000781_03 euxassay_000781_04
EMAGE:10560 EMAGE:10560 EMAGE:10560 EMAGE:10560 EMAGE:10560
euxassay_000781_05 euxassay_000781_06 euxassay_000781_07 euxassay_000781_08 euxassay_000781_09
EMAGE:10560 EMAGE:10560 EMAGE:10560 EMAGE:10560 EMAGE:10560
euxassay_000781_10 euxassay_000781_11 euxassay_000781_12 euxassay_000781_13 euxassay_000781_14
EMAGE:10560 EMAGE:10560 EMAGE:10560 EMAGE:10560 EMAGE:10560
euxassay_000781_15 euxassay_000781_16 euxassay_000781_17 euxassay_000781_18 euxassay_000781_19
EMAGE:10560 EMAGE:10560 EMAGE:10560 EMAGE:10560 EMAGE:10560
euxassay_000781_20 euxassay_000781_21 euxassay_000781_22 euxassay_000781_23 euxassay_000781_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10560Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10560_wholemount_strong.wlz
10560_wholemount_moderate.wlz
10560_wholemount_weak.wlz
10560_wholemount_possible.wlz
10560_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10560_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T156
Entity Detected:St3gal4, ST3 beta-galactoside alpha-2,3-sialyltransferase 4 ( MGI:1316743)
Sequence:sense strand is shown

>T156
GTCTGACTGTGAAACCCTGGCTAATCTGGAACTCACTATGTAGACCAGACTGGTCTTGAACTCACAGAGA
TCCAACTGCCTTTGCCTCCCAAGTGTTGGGATGAAAGGCATGTACTACGCCTGGCCCCAACACCAAGAGA
TTATTTAACATTCTATTTAATTAAGGGGTAGGAAAATGAATGGGCTGGTCCCAGGATGTTCATGAAAGGG
ACACAATACAGTGTTCTGCCCACTTTTTAATAAAATTTACATGTGATTGGCCTGTTAAGGCCCAATTCTA
GAGCTGGCCTCCCAGAAAGATGGAGGCATCAAGAGTGGGAGGGTGTCCTCCAGAGAGGGGTTGCTACTTC
CCAGCAGGCATGGGGGGAGCATTGACAAGGGGGTTCCACCTAGAAGGGGCCTCACCTTGAAAAGAGGTTG
TAAAAGACCATTAAAATATTTTTTTTTCTAAAATGGAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:2631153 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2631153 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10562 same embryo
 EMAGE:10559 same embryo
 EMAGE:10558 same embryo
 EMAGE:10557 same embryo
 EMAGE:10561 same embryo
 EurExpress:euxassay_000781 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS