Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10652

6530418L21Rik RIKEN cDNA 6530418L21 gene ( MGI:1923497)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10652 EMAGE:10652 EMAGE:10652 EMAGE:10652 EMAGE:10652
"Pseudo-wholemount" of euxassay_000863. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000863_01 euxassay_000863_02 euxassay_000863_03 euxassay_000863_04
EMAGE:10652 EMAGE:10652 EMAGE:10652 EMAGE:10652 EMAGE:10652
euxassay_000863_05 euxassay_000863_06 euxassay_000863_07 euxassay_000863_08 euxassay_000863_09
EMAGE:10652 EMAGE:10652 EMAGE:10652 EMAGE:10652 EMAGE:10652
euxassay_000863_10 euxassay_000863_11 euxassay_000863_12 euxassay_000863_13 euxassay_000863_14
EMAGE:10652 EMAGE:10652 EMAGE:10652 EMAGE:10652 EMAGE:10652
euxassay_000863_15 euxassay_000863_16 euxassay_000863_17 euxassay_000863_18 euxassay_000863_19
EMAGE:10652 EMAGE:10652 EMAGE:10652 EMAGE:10652 EMAGE:10652
euxassay_000863_20 euxassay_000863_21 euxassay_000863_22 euxassay_000863_23 euxassay_000863_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10652Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10652_wholemount_strong.wlz
10652_wholemount_moderate.wlz
10652_wholemount_weak.wlz
10652_wholemount_possible.wlz
10652_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10652_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 10 11 12 16 17 18 19
diencephalon lateral wall ventricular layer
moderate moderate
homogeneousmoderate expression: see section 13 15
telencephalon mantle layer
weak weak
single cellweak expression: see section 02 03 04 05 06 07 08 09 12 13 14 15 16 17 18 19 21
medulla oblongata alar plate mantle layer
moderate moderate
single cellmoderate expression: see section 13 14 15
medulla oblongata basal plate mantle layer
moderate moderate
single cellmoderate expression: see section 08 09 10 11 12 14 15 16 17 18 19
cerebellum intraventricular portion marginal layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
pons mantle layer
moderate moderate
single cellmoderate expression: see section 07 09 10 11 12 14 15 16 17 18 19
midbrain mantle layer
moderate moderate
single cellmoderate expression: see section 15
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 14
ventral grey horn
moderate moderate
regionalmoderate expression: see section 13 14 15 weak expression: see section 12 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2140
Entity Detected:6530418L21Rik, RIKEN cDNA 6530418L21 gene ( MGI:1923497)
Sequence:sense strand is shown

>T2140
TTTCCTGCAGACCTGGTGGGTAACTGGCTANATNTACCAGAACTGGAAAAGGGCGGGGAAAAGGGTGAGA
CTGGGGGATCCATTGAACCCAAAGGAGAAAAAGGCCAGTCCAGAGAGCTGGGTCGTAAGTTTGCCCTAAC
CGCAAACATTTTTAGGAAGTTCTTGCGTAGCGTGCGGCCCGACAGAGACCGGCTGCTCAAGGAGAAGCCT
GGCTGGATGACTCCCATGGTCTCTGAGTCACGAGCAGGACGCTCGAAGAAAGTCAAGAAGAGGAGCCTTT
CTAAGGGCTCAGGACGGTTCCCTTTCTCAAGCACAGGAGAGCCCAGACATATTGAAACCCCCGCCACAAG
CAGCCCCAAGGCCTTAGAACCCTCCTGTAGGGGCTTTGACATTAACACAGCTGTTTGGGTCTGAANAAAA
AAAAAANNAAA
Notes:The probe template was PCR amplified from IMAGE:874260 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:874260 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10648 same embryo
 EMAGE:10649 same embryo
 EMAGE:10650 same embryo
 EMAGE:10651 same embryo
 EurExpress:euxassay_000863 same experiment
 MGI:4822788 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS