Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10674

Csdc2 cold shock domain containing C2, RNA binding ( MGI:2146027)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10674 EMAGE:10674 EMAGE:10674 EMAGE:10674 EMAGE:10674
"Pseudo-wholemount" of euxassay_000899. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000899_01 euxassay_000899_02 euxassay_000899_03 euxassay_000899_04
EMAGE:10674 EMAGE:10674 EMAGE:10674 EMAGE:10674 EMAGE:10674
euxassay_000899_05 euxassay_000899_06 euxassay_000899_07 euxassay_000899_08 euxassay_000899_09
EMAGE:10674 EMAGE:10674 EMAGE:10674 EMAGE:10674 EMAGE:10674
euxassay_000899_10 euxassay_000899_11 euxassay_000899_12 euxassay_000899_13 euxassay_000899_14
EMAGE:10674 EMAGE:10674 EMAGE:10674 EMAGE:10674 EMAGE:10674
euxassay_000899_15 euxassay_000899_16 euxassay_000899_17 euxassay_000899_18 euxassay_000899_19
EMAGE:10674 EMAGE:10674 EMAGE:10674 EMAGE:10674 EMAGE:10674
euxassay_000899_20 euxassay_000899_21 euxassay_000899_22 euxassay_000899_23 euxassay_000899_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10674Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10674_wholemount_strong.wlz
10674_wholemount_moderate.wlz
10674_wholemount_weak.wlz
10674_wholemount_possible.wlz
10674_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10674_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 11 12 moderate expression: see section 10 14 15
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 11 12 moderate expression: see section 13
cerebral cortex
strong strong
homogeneousstrong expression: see section 05 06 07 08 09 10 11 18 19 20 21 moderate expression: see section 03 04
corpus striatum
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 18 19 20 21
olfactory cortex mantle layer
moderate moderate
homogeneousmoderate expression: see section 10 11 12 15 16 18
not examined not examined
homogeneousnot examined expression: see section 10 11 12
facial vii ganglion
strong strong
homogeneousstrong expression: see section 03 04 20
glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 03
inferior glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 06 07 moderate expression: see section 18
superior glossopharyngeal ix ganglion
moderate moderate
homogeneousmoderate expression: see section 06 07 18
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 02 04 05 06 07 08 18 19 20 moderate expression: see section 17 21 22
inferior vagus x ganglion
strong strong
homogeneousstrong expression: see section 08 moderate expression: see section 17
superior vagus x ganglion
strong strong
homogeneousstrong expression: see section 08 moderate expression: see section 17
vestibulocochlear viii ganglion vestibular component
strong strong
homogeneousstrong expression: see section 04 05 19 moderate expression: see section 20
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2174
Entity Detected:Csdc2, cold shock domain containing C2, RNA binding ( MGI:2146027)
Sequence:sense strand is shown

>T2174
AATTCGGATCCACGTGCCCTGAGAAATGGCTGCAAGCAGGAGGGAACTTTAGCACTCCTGTTATGTAGGC
CAGTCCTCTCTCCTCAGCTGTCAGATGATCTTTGAACCCCACAGAGCTGAGGAAGCCAAGCTCACTCACT
CCCTGAGGTGAGGCGGGGATAGGGTTTCCTTCCAGCTTGCTCTTCTACCCGGGATGCTCAAACCTCACGA
ATGCTCTGGCCCATTGCTGGCCATGACAGCAGCTGAGGATGCAGCAATGGACTGACATGTCACCTCAGGC
AAGGCCAGGTCCAGGCACCCAAAGGATCGGTCCTCAGCCAGGGAGACCACTGGCTTTGCCCCTCCCACCC
CCCATGAGATCCTCTTCCCAGAGCTATGCAATGGCTCTCATAAGCCCCTGACAGGTCAGCAGCTGAGGTG
GCTCTTATCTCTCTTGTCCCCAAGTGTGACTGTCCCTCTTCCCTGGAGTCCCTTTGGAGCTGTGTCCCTT
CTAGAGAGCCAGTTACTTAACCAGAGGATAAGTGAGGTCACA
Notes:The probe template was PCR amplified from IMAGE:889232 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:889232 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10670 same embryo
 EMAGE:10672 same embryo
 EMAGE:10669 same embryo
 EMAGE:10671 same embryo
 EMAGE:10673 same embryo
 EurExpress:euxassay_000899 same experiment
 MGI:4824076 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS