EMAGE mouse gene expression spatial database

EMAGE:10793

1110058L19Rik RIKEN cDNA 1110058L19 gene ( MGI:1915252)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_003239. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_003239_01	euxassay_003239_02	euxassay_003239_03	euxassay_003239_04

euxassay_003239_05	euxassay_003239_06	euxassay_003239_07	euxassay_003239_08	euxassay_003239_09

euxassay_003239_10	euxassay_003239_11	euxassay_003239_12	euxassay_003239_13	euxassay_003239_14

euxassay_003239_15	euxassay_003239_16	euxassay_003239_17	euxassay_003239_18	euxassay_003239_19

euxassay_003239_20	euxassay_003239_21	euxassay_003239_22	euxassay_003239_23

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T5418
Entity Detected:	1110058L19Rik, RIKEN cDNA 1110058L19 gene ( MGI:1915252)
Sequence:	sense strand is shown >T5418 GCGCAATGGTCTCCACGACCCTTTCCGTTTCACGGATGACTTTCGTCTGGAGAGCAGCAAGACCATCTCT TCTGAATCATTCTTTGAGGAAAATGAGTTATCAGGAAGGAAAGCCTGAGCCTGCGAAGCAAGCCCTTAAG AAGTCAAAGCTGCCACTCGGTCGTTTTGACTCACTGGAGGATTCACCCGAAGAGAGAGAGCCACTGCAGA AGTTTCCGGATGATGTAAATCCAGTTACCAAAGAAAAAGGTGGACCCAAGGGCCCGGAGCCTACACGATA TGGAGACTGGGAACGGAAGGGACGCTGCATTGACTTTTAAGTCACGCACTCTCACAACTGCAGAATCATT ACCTGAACTGTTTACTTCAAGTTGTTTTCTTTTTCTGTGTCCTTTAAGTGTGTAATTTCCATCGTATGTC CTAAAATGCATGTGACAGCTTTGAATAGCAAATGCTGCTATAGATGAGGAATGTGGAAACGCTTCCATTA GCATCTTAACCTCACCTTAAGTGTGTCAGGGCAGAGTCTGGGATGAGAGCATCAAGTCTTTGCCACGATC TTTTTGTCATTTATTTAATCAGTTGCTTATAAAATACATGTGTAAATAAAGACCTCTTGAAATTTTTAAA AAAAAAAAAAAAAAAAAAAAAAA
Notes:	The probe template was PCR amplified from IMAGE:5367409 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:5367409 which was retrieved directly from NCBI.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:10794 same embryo
	EMAGE:10791 same embryo
	EMAGE:10792 same embryo
	EurExpress:euxassay_003239 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source