Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11904

Itga7 integrin alpha 7 ( MGI:102700)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11904 EMAGE:11904 EMAGE:11904 EMAGE:11904 EMAGE:11904
"Pseudo-wholemount" of euxassay_010969. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010969_01 euxassay_010969_02 euxassay_010969_03 euxassay_010969_04
EMAGE:11904 EMAGE:11904 EMAGE:11904 EMAGE:11904 EMAGE:11904
euxassay_010969_05 euxassay_010969_06 euxassay_010969_07 euxassay_010969_08 euxassay_010969_09
EMAGE:11904 EMAGE:11904 EMAGE:11904 EMAGE:11904 EMAGE:11904
euxassay_010969_10 euxassay_010969_11 euxassay_010969_12 euxassay_010969_13 euxassay_010969_14
EMAGE:11904 EMAGE:11904 EMAGE:11904 EMAGE:11904 EMAGE:11904
euxassay_010969_15 euxassay_010969_16 euxassay_010969_17 euxassay_010969_18 euxassay_010969_19
EMAGE:11904 EMAGE:11904 EMAGE:11904 EMAGE:11904
euxassay_010969_20 euxassay_010969_21 euxassay_010969_22 euxassay_010969_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11904Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11904_wholemount_strong.wlz
11904_wholemount_moderate.wlz
11904_wholemount_weak.wlz
11904_wholemount_possible.wlz
11904_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11904_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
weak weak
spottedweak expression: see section 02 03 04 21 22 23
upper leg muscle
weak weak
spottedweak expression: see section 05 06 07 08 09 10 19 20 21 22 23
diaphragm
weak weak
spottedweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 19 20 21 22 23
pericardial cavity
weak weak
spottedweak expression: see section 18
lower leg rest of mesenchyme
weak weak
spottedweak expression: see section 04
vertebral axis musculature
weak weak
spottedweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 08 09 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 18 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 09
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 18 19
tongue muscle
weak weak
spottedweak expression: see section 10 11 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36526
Entity Detected:Itga7, integrin alpha 7 ( MGI:102700)
Sequence:sense strand is shown

>T36526
TTTTACCTCATCCTCAGCACCTCTGGGATCACTATTGAGACCACAGAGCTGGAGGTGAAATTGCTGTTAG
CCACGATCAGTGAGCAGGAGCTGGATCCGGTCTCCGTTCGGGCTCATGTCTTCATTGAATTGCCACTGTC
CATTTCAGGGGTGGCCACTCCCCAGCAACTCTTCTTCTCTGGCGAGGTCAAGGGCGAAAGTGCCATGCGA
TCTGAGAGGGAGCTGGGACGCAAAGTCAAGTATGAGGTCACGGTCTCCAATCAAGGCCAGTCTCTCAATA
CTCTGGGCTCTGCGAACCTCAACATCATGTGGCCCCACGAGATCGCCAATGGAAAGTGGCTGCTGTACCC
CATGCGGGTAGAGCTGGAGGGCGGACAGGGGCCTGGCAAGAGAGGGATCTGTTCCCCAAGACCCAACATC
CTCCAGCTGGATGTGGACAGCAGGGATAGGAGGCGGCGAGAGCTGGGGCAGCCGGAGCCGCAGGAGCCTC
CAGAGAAGGTGGAGCCTAGCACATCCTGGTGGCCAGTGTCCTCTGCTGAGAAGAGAAACATGACTCTGGA
CTGCCCCAGGACGGCCAAGTGTGTGGTGTTCAGCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 97954. Forward Primer - name:097954_F_cDNA_Itga7, sequence:TTTTACCTCATCCTCAGCACCT; Reverse Primer - name:097954_N_SP6_cDNA_Itga7, sequence:CAGCTGAACACCACACACTTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11906 same embryo
 EMAGE:11905 same embryo
 EMAGE:11907 same embryo
 EurExpress:euxassay_010969 same experiment
 MGI:4825645 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS