Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11925

Lama1 laminin, alpha 1 ( MGI:99892)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11925 EMAGE:11925 EMAGE:11925 EMAGE:11925 EMAGE:11925
"Pseudo-wholemount" of euxassay_011017. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011017_01 euxassay_011017_02 euxassay_011017_03 euxassay_011017_04
EMAGE:11925 EMAGE:11925 EMAGE:11925 EMAGE:11925 EMAGE:11925
euxassay_011017_05 euxassay_011017_06 euxassay_011017_07 euxassay_011017_08 euxassay_011017_09
EMAGE:11925 EMAGE:11925 EMAGE:11925 EMAGE:11925 EMAGE:11925
euxassay_011017_10 euxassay_011017_11 euxassay_011017_12 euxassay_011017_13 euxassay_011017_14
EMAGE:11925 EMAGE:11925 EMAGE:11925 EMAGE:11925 EMAGE:11925
euxassay_011017_15 euxassay_011017_16 euxassay_011017_17 euxassay_011017_18 euxassay_011017_19
EMAGE:11925 EMAGE:11925 EMAGE:11925 EMAGE:11925
euxassay_011017_20 euxassay_011017_21 euxassay_011017_22 euxassay_011017_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11925Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11925_wholemount_strong.wlz
11925_wholemount_moderate.wlz
11925_wholemount_weak.wlz
11925_wholemount_possible.wlz
11925_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11925_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13
diencephalon meninges
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
telencephalon meninges
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain meninges
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13
spinal cord meninges
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14
cornea epithelium
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 23
lens
moderate moderate
regionalmoderate expression: see section 01
urinary system
moderate moderate
regionalmoderate expression: see section 03 04 21
maturing glomerular tuft
strong strong
regionalstrong expression: see section 05 06 07 08 09 15 16 17 18 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36576
Entity Detected:Lama1, laminin, alpha 1 ( MGI:99892)
Sequence:sense strand is shown

>T36576
AGGAATCGGAGAGTTATCACCATACAAGTGGATGAGAACAGTCCCGTAGAAATGAAGTTGGGTCCATTAA
CAGAAGGAAAGACGATCGACATATCCAACCTGTACATAGGGGGACTTCCGGAGGACAAGGCGACCCCGAT
GCTCAAGATGCGGACTTCGTTCCATGGGTGTATTAAAAACGTGGTCCTTGACGCTCAACTTTTGGACTTC
ACCCATGCGACTGGCTCTGAGCAAGTAGAGCTGGACACATGCTTGCTGGCAGAAGAGCCCATGCAGAGTC
TGCACAGAGAACACGGGGAACTCCCTCCGGAGCCCCCAACTCTACCACAGCCTGAACTGTGCGCAGTAGA
CACGGCTCCGGGGTATGTGGCAGGTGCTCACCAGTTTGGCCTCTCGCAGAACAGCCACTTGGTGCTCCCT
CTGAATCAGTCTGATGTCCGGAAGAGGCTCCAGGTGCAGCTGAGCATTCGGACATTTGCCTCCAGTGGCC
TCATTTACTATGTGGCTCATCAGAACCAAATGGACTACGCCACGCTCCAGCTCCAAGAGGGCCGCCTGCA
CTTCATGTTTGATCTCGGCAAGGGCCGGACCAAGGTCTCCCACCCTGCCCTGCTCAGTGATGGCAAGTGG
CACACAGTCAAGACAGAATACATTAAAAGGAAGGCGTTCATGACTGTTGACGGCCAAGAGTCCCCCAGTG
TGACTGTGGTGGGCAAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 98039. Forward Primer - name:098039_F_cDNA_Lama1, sequence:AGGAATCGGAGAGTTATCACCA; Reverse Primer - name:098039_N_SP6_cDNA_Lama1, sequence:ATTGCCCACCACAGTCACACT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11928 same embryo
 EMAGE:11927 same embryo
 EMAGE:11924 same embryo
 EMAGE:11923 same embryo
 EMAGE:11926 same embryo
 EurExpress:euxassay_011017 same experiment
 MGI:4825857 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS