Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11929

Nckap5 NCK-associated protein 5 ( MGI:2686394)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11929 EMAGE:11929 EMAGE:11929 EMAGE:11929 EMAGE:11929
"Pseudo-wholemount" of euxassay_008577. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008577_01 euxassay_008577_02 euxassay_008577_03 euxassay_008577_04
EMAGE:11929 EMAGE:11929 EMAGE:11929 EMAGE:11929 EMAGE:11929
euxassay_008577_05 euxassay_008577_06 euxassay_008577_07 euxassay_008577_08 euxassay_008577_09
EMAGE:11929 EMAGE:11929 EMAGE:11929 EMAGE:11929 EMAGE:11929
euxassay_008577_10 euxassay_008577_11 euxassay_008577_12 euxassay_008577_13 euxassay_008577_14
EMAGE:11929 EMAGE:11929 EMAGE:11929 EMAGE:11929 EMAGE:11929
euxassay_008577_15 euxassay_008577_16 euxassay_008577_17 euxassay_008577_18 euxassay_008577_19
EMAGE:11929 EMAGE:11929 EMAGE:11929 EMAGE:11929
euxassay_008577_20 euxassay_008577_21 euxassay_008577_22 euxassay_008577_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11929Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11929_wholemount_strong.wlz
11929_wholemount_moderate.wlz
11929_wholemount_weak.wlz
11929_wholemount_possible.wlz
11929_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11929_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hypothalamus ventricular layer
weak weak
homogeneousweak expression: see section 12 13 14
diencephalon lateral wall ventricular layer
weak weak
homogeneousweak expression: see section 12 13 14
olfactory cortex ventricular layer
weak weak
homogeneousweak expression: see section 10 11 15 16 17
telencephalon ventricular layer
weak weak
homogeneousweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22
medulla oblongata basal plate ventricular layer
weak weak
homogeneousweak expression: see section 10 11 12 14 15 16 17
rest of cerebellum ventricular layer
weak weak
homogeneousweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
pons ventricular layer
weak weak
homogeneousweak expression: see section 09 10 11 12 14 15
midbrain ventricular layer
weak weak
homogeneousweak expression: see section 10 11 12 13 14 15 16
spinal cord ventricular layer
weak weak
homogeneousweak expression: see section 14 15
lung
moderate moderate
regionalmoderate expression: see section 05 06 07 09 10 11 12 13 14 15 17 18 19 20 21 22 23 weak expression: see section 08 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36234
Entity Detected:Nckap5, NCK-associated protein 5 ( MGI:2686394)
Sequence:sense strand is shown

>T36234
GAACAGGGGGTGTGGTTAAATATAGCTCCTCCTACTGGAACTCCAGAACTGCCTATGCACTTAGGCGTGT
AGGAGCGCCGTGCTTCCAAAACTGCCAGTCCTGGTCCCAGGAGGGCTCACATTGTACACACAGTTGGAAA
CAGGGACAGGTTTCTGAATATTCAGTGGCCAGAAATCAGTTCAATATGAAGCGGATGATGATTTTTCTGG
CACTTCTGGCAGCATGCCCCTATGCTGTAGGCTTTGTTCTGAATACACTGCATACTTCCCAGTATGTCAA
GCTATGCAGTGTTGCCATGCAGAATCAGGTCCCAGCGCAGTGTGCCTGTTAGAAGTTACGGTGTCTTTAT
TGCACATTACATCTTATAATCTTAGAGAAACATGGTGGGTGGTTTTTTTTTTTTTTCATGTTCTCCAAGA
ACAAAAGTGTTTAATAGTTTCCTATTTCCCACGGCATGAAAGCAACAAATTAATATATATCTAGACTGTG
TCATATTAGAATGTCTCGCTTTTAGATTGCTGTTCAAGTTTCTAACTTGAGTTCCATAAAATAATCTGCT
AGATGAATTGTGGCATGTGATTTGGACAGAAATTTCAGCTGTTTCTCTAATAACACGATACATACGTCTG
ACTTTTTGAACTATGAATTTATATGAATATATAATGCCATTCCCCAAATTGACAGTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 69127. Forward Primer - name:069127_F_cDNA_D130011D22Rik, sequence:GAACAGGGGGTGTGGTTAAATA; Reverse Primer - name:069127_N_SP6_cDNA_D130011D22Rik, sequence:AACTGTCAATTTGGGGAATGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11931 same embryo
 EMAGE:11932 same embryo
 EMAGE:11930 same embryo
 EMAGE:11934 same embryo
 EMAGE:11933 same embryo
 EurExpress:euxassay_008577 same experiment
 MGI:4826620 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS