Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11951

Map3k1 mitogen-activated protein kinase kinase kinase 1 ( MGI:1346872)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11951 EMAGE:11951 EMAGE:11951 EMAGE:11951 EMAGE:11951
"Pseudo-wholemount" of euxassay_011095. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011095_01 euxassay_011095_02 euxassay_011095_03 euxassay_011095_04
EMAGE:11951 EMAGE:11951 EMAGE:11951 EMAGE:11951 EMAGE:11951
euxassay_011095_05 euxassay_011095_06 euxassay_011095_07 euxassay_011095_08 euxassay_011095_09
EMAGE:11951 EMAGE:11951 EMAGE:11951 EMAGE:11951 EMAGE:11951
euxassay_011095_10 euxassay_011095_11 euxassay_011095_12 euxassay_011095_13 euxassay_011095_14
EMAGE:11951 EMAGE:11951 EMAGE:11951 EMAGE:11951 EMAGE:11951
euxassay_011095_15 euxassay_011095_16 euxassay_011095_17 euxassay_011095_18 euxassay_011095_19
EMAGE:11951 EMAGE:11951 EMAGE:11951 EMAGE:11951 EMAGE:11951
euxassay_011095_20 euxassay_011095_21 euxassay_011095_22 euxassay_011095_23 euxassay_011095_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11951Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11951_wholemount_strong.wlz
11951_wholemount_moderate.wlz
11951_wholemount_weak.wlz
11951_wholemount_possible.wlz
11951_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11951_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
sublingual gland primordium
weak weak
regionalweak expression: see section 10 17
submandibular gland primordium
weak weak
regionalweak expression: see section 09 10 18 19 20
thyroid gland
weak weak
regionalweak expression: see section 11 15 16
vibrissa
weak weak
regionalweak expression: see section 05 06 07 08 09 22 23 24
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 16 17 weak expression: see section 09 18 19
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 20 21 22 23
pharyngo-tympanic tube
weak weak
regionalweak expression: see section 01 02 22 23 24
naris
weak weak
regionalweak expression: see section 14 17 19
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 11 12 13 14 17 18 19 20
lower jaw incisor
weak weak
regionalweak expression: see section 12 13 17 18
lower jaw molar
weak weak
regionalweak expression: see section 07
oral epithelium
moderate moderate
regionalmoderate expression: see section 21 22 weak expression: see section 06 07 08 09 20 23
upper jaw incisor
weak weak
regionalweak expression: see section 13 17 18
upper jaw molar
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 07
urinary system
moderate moderate
spottedmoderate expression: see section 05 06 23
kidney calyx
moderate moderate
regionalmoderate expression: see section 07 09 10 19 20 21 weak expression: see section 08 11 18
kidney pelvis
moderate moderate
regionalmoderate expression: see section 09 20
larynx
weak weak
regionalweak expression: see section 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36614
Entity Detected:Map3k1, mitogen-activated protein kinase kinase kinase 1 ( MGI:1346872)
Sequence:sense strand is shown

>T36614
ATCATCATTCAGCAGGACACACCAGAAACTCTTCCAGGACATACCAAAGCGAAACAGCCTTACAGAGAAG
ACGCTGAGTGGCTGAAAGGCCAGCAGATAGGCCTCGGAGCATTTTCTTCCTGTTACCAAGCACAGGATGT
GGGGACTGGGACTTTAATGGCTGTGAAACAGGTGACGTACGTCAGAAACACATCCTCCGAGCAGGAGGAG
GTGGTGGAAGCGTTGAGGGAAGAGATCCGGATGATGGGTCACCTCAACCATCCAAACATCATCCGGATGC
TGGGGGCCACGTGCGAGAAGAGCAACTACAACCTCTTCATTGAGTGGATGGCGGGAGGATCTGTGGCTCA
CCTCTTGAGTAAATACGGAGCTTTCAAGGAGTCAGTCGTCATTAACTACACTGAGCAGTTACTGCGTGGC
CTTTCCTATCTCCACGAGAACCAGATCATTCACAGAGACGTCAAAGGTGCCAACCTGCTCATTGACAGCA
CCGGTCAGAGGCTGAGAATTGCAGACTTTGGAGCTGCTGCCAGGTTGGCATCAAAAGGAACCGGTGCAGG
AGAGTTCCAGGGACAGTTACTGGGGACAATTGCATTCATGGCGCCTGAGGTCCTAAGAGGTCAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 90561. Forward Primer - name:090561_F_cDNA_Map3k1, sequence:ATCATCATTCAGCAGGACACAC; Reverse Primer - name:090561_N_SP6_cDNA_Map3k1, sequence:CTGACCTCTTAGGACCTCAGGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11954 same embryo
 EMAGE:11953 same embryo
 EMAGE:11950 same embryo
 EMAGE:11952 same embryo
 EurExpress:euxassay_011095 same experiment
 MGI:4826079 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS