Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12025

Gpr125 G protein-coupled receptor 125 ( MGI:1917943)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12025 EMAGE:12025 EMAGE:12025 EMAGE:12025 EMAGE:12025
"Pseudo-wholemount" of euxassay_008255. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008255_01 euxassay_008255_02 euxassay_008255_03 euxassay_008255_04
EMAGE:12025 EMAGE:12025 EMAGE:12025 EMAGE:12025 EMAGE:12025
euxassay_008255_05 euxassay_008255_06 euxassay_008255_07 euxassay_008255_08 euxassay_008255_09
EMAGE:12025 EMAGE:12025 EMAGE:12025 EMAGE:12025 EMAGE:12025
euxassay_008255_10 euxassay_008255_11 euxassay_008255_12 euxassay_008255_13 euxassay_008255_14
EMAGE:12025 EMAGE:12025 EMAGE:12025 EMAGE:12025 EMAGE:12025
euxassay_008255_15 euxassay_008255_16 euxassay_008255_17 euxassay_008255_19 euxassay_008255_20
EMAGE:12025 EMAGE:12025 EMAGE:12025 EMAGE:12025
euxassay_008255_21 euxassay_008255_22 euxassay_008255_23 euxassay_008255_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12025Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12025_wholemount_strong.wlz
12025_wholemount_moderate.wlz
12025_wholemount_weak.wlz
12025_wholemount_possible.wlz
12025_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12025_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 10 11 15 16 17 19 20 21 22 23 moderate expression: see section 12 13 14
forearm mesenchyme
strong strong
regionalstrong expression: see section 01 02 03
upper arm mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 21 22 23 24 moderate expression: see section 07
hand
strong strong
regionalstrong expression: see section 02 03 04 05 21 22 23 24
foot
strong strong
regionalstrong expression: see section 02 03 04 05 19 20 21 22 23 24
lower leg mesenchyme
strong strong
regionalstrong expression: see section 01 02 21 22 23 24
upper leg mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 19 20 21 22 23 24
submandibular gland primordium
strong strong
regionalstrong expression: see section 08 09 10 11 12 19 20 21
vibrissa
strong strong
regionalstrong expression: see section 06 07 08 09 10 22 23 24
otic capsule
strong strong
regionalstrong expression: see section 08 09 10 17 19 20
cochlea
strong strong
regionalstrong expression: see section 08 09 10 17 19 20 21
utricle
strong strong
regionalstrong expression: see section 05 06 07 08 21 22 23 moderate expression: see section 24
nasal septum
strong strong
regionalstrong expression: see section 15 16 17
naso-lacrimal duct
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 20 21 22 23 24
viscerocranium
strong strong
regionalExpression in the turbinate bone.
tongue muscle
strong strong
regionalstrong expression: see section 15 16 moderate expression: see section 13 14 17
mandible
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 13 14 15 16 17 19 21 moderate expression: see section 02 03 11 12 20 22 23 24
lower jaw incisor
strong strong
regionalstrong expression: see section 13 14 15 16 19
lower jaw molar
strong strong
regionalstrong expression: see section 08 09 20 21
maxilla
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 13 14 15 16 17 19 21 moderate expression: see section 20 22 23 24
upper jaw incisor
strong strong
regionalstrong expression: see section 13 14 15 19
upper jaw molar
strong strong
regionalstrong expression: see section 08 09 20 21 22
renal cortex
strong strong
regionalstrong expression: see section 06 07 08 09 10 17 19 20
axial skeleton
strong strong
regionalstrong expression: see section 09 10 11 16 moderate expression: see section 12 13 14 15
basisphenoid bone
strong strong
regionalstrong expression: see section 13 14 15 16 17
temporal bone petrous part
strong strong
regionalstrong expression: see section 05 06 21 22 23 moderate expression: see section 02 03 04 24
orbito-sphenoid
strong strong
regionalstrong expression: see section 02 03 04 05 07 08 09 10 21 22 23 moderate expression: see section 24
sternum
strong strong
regionalstrong expression: see section 15 moderate expression: see section 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35189
Entity Detected:Gpr125, G protein-coupled receptor 125 ( MGI:1917943)
Sequence:sense strand is shown

>T35189
AAGTCACCAAGAAAGCCAAGAGATGCCAGGATCCAGATGAGCCACCCGCTCCTCCACGACCGATGCTGAG
GTTCTACCTGATTGGTGGTGGGATCCCCATCATAGTGTGTGGTATCACCGCGGCAGCAAACATCAAGAAC
TATGGCAGTCGGCCCAGTGCACCGTATTGCTGGATGGCCTGGGAACCGTCCTTGGGAGCCTTCTACGGAC
CTGCCAGCTTCATCACTTTTGTAAACTGTATGTATTTTCTAAGCATATTTATTCAGTTGAAAAGACACCC
TGAGCGCAAATATGAGCTCAAGGAGCCGACAGAAGAGCAGCAGAGATTGGCAGCCAATGAAAATGGTGAA
ATCAACCATCAGGACTCCATGTCTCTGTCTCTCATCTCTACGTCCACGTTGGAGAACGAGCACAGTTTTC
AGTCTCAGCTTCTGGGCGCCAGCCTTACTTTGCTTTTGTATGTCATCTTGTGGATGTTTGGGGCCATGGC
TGTTTCTCTGTATTACCCTCTGGACTTGGTTTTTAGCTTCTTCTTCGGAGCCACTTGTTTAAGCTTCAGT
GCTTTCATGATGGTGCACCACTGCATCAACAGGGAGGACGTGAGACTTGCGTGGATCATGATGTGCTGCC
CAGGGCGGAGCTCGTACTCCGTGCAAGTCAACGTCCAACCTCCCAACTCAAGCGCCACTAATGGAGAGGC
TCCAAAGTGCACCAATAGCAGCGCAGAGTCTTCGTGCACGAACAAAAGCGCATCGAGCTTCAAAAACTCT
TCCCAGGGCTGCAAGCTGACAAACTTGCAGGCTGCTGCGGCACAGTACCACAGCAATGCCCTACCTGTGA
ATGCCACGCCGCAGCTTGATAACAGTCTGAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 78738. Forward Primer - name:078738_F_cDNA_Gpr125, sequence:AAGTCACCAAGAAAGCCAAGAG; Reverse Primer - name:078738_N_SP6_cDNA_Gpr125, sequence:GTCAGACTGTTATCAAGCTGCG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12022 same embryo
 EMAGE:12026 same embryo
 EMAGE:12027 same embryo
 EMAGE:12024 same embryo
 EMAGE:12023 same embryo
 EurExpress:euxassay_008255 same experiment
 MGI:4825171 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS