Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12049

Gabrb3 gamma-aminobutyric acid (GABA) A receptor, subunit beta 3 ( MGI:95621)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12049 EMAGE:12049 EMAGE:12049 EMAGE:12049 EMAGE:12049
"Pseudo-wholemount" of euxassay_008367. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008367_01 euxassay_008367_02 euxassay_008367_03 euxassay_008367_04
EMAGE:12049 EMAGE:12049 EMAGE:12049 EMAGE:12049 EMAGE:12049
euxassay_008367_05 euxassay_008367_06 euxassay_008367_07 euxassay_008367_08 euxassay_008367_09
EMAGE:12049 EMAGE:12049 EMAGE:12049 EMAGE:12049 EMAGE:12049
euxassay_008367_10 euxassay_008367_11 euxassay_008367_12 euxassay_008367_13 euxassay_008367_14
EMAGE:12049 EMAGE:12049 EMAGE:12049 EMAGE:12049 EMAGE:12049
euxassay_008367_15 euxassay_008367_16 euxassay_008367_17 euxassay_008367_18 euxassay_008367_19
EMAGE:12049 EMAGE:12049 EMAGE:12049 EMAGE:12049 EMAGE:12049
euxassay_008367_20 euxassay_008367_21 euxassay_008367_22 euxassay_008367_23 euxassay_008367_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12049Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12049_wholemount_strong.wlz
12049_wholemount_moderate.wlz
12049_wholemount_weak.wlz
12049_wholemount_possible.wlz
12049_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12049_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 09 10 11 12 13 14 15 17 18 19 20 21 22 23 24 moderate expression: see section 08 16
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 20 21
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 18 moderate expression: see section 06 07 08
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 17 18 19 20 21 22 moderate expression: see section 06 07 08
vagus x ganglion
strong strong
regionalstrong expression: see section 17 moderate expression: see section 09
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 17 18 moderate expression: see section 07
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 22 23 weak expression: see section 24
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 09 11 14 15 16
mandible
moderate moderate
regionalmoderate expression: see section 02 22 23 weak expression: see section 03 04 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35166
Entity Detected:Gabrb3, gamma-aminobutyric acid (GABA) A receptor, subunit beta 3 ( MGI:95621)
Sequence:sense strand is shown

>T35166
ATGTGAATGCCATAGACAGGTGGTCCCGCATCGTGTTTCCATTCACCTTTTCTCTCTTCAATTTAGTTTA
CTGGCTGTACTATGTTAACTGAGTGACTGTACTTGATTTTTCAAAGACTTCATTTAACACTGAGTGAAAT
ATTACCCTGCCTGTCAAGTTTTTATACCAGTACACATACAAACACACACACACATACGCACACACACACA
CACGGACACACACACAATTGTGTATATATATGTGAACTTTCTCAGCATATATATAAAATACACGTGTATA
TGAGAATGTATGTGTATATGTTCAAGGACACAGATAAGAGTATCTGTGTACATAAAACAAATACGCATAC
ATACCATACATTTTGCAACTATGGACAATTTAACACAGGATGCATATTAAAGAAACTCATAGCTTTTTCT
TTCTTTTTTTAATTGAAAGGGACAAGTATCTAAATATTATGCCTCAAGAATGAGGGCGTGAAACACAGTC
ATCCCAAAGTGTGTCTTTTATTATCATAAGTTAGATATTTTCGCTTAAAAATCCAAAAGGAATTCTTAGT
TAATCTTTGGGAACTCCCACAGCCGTAGTTGTACACCTCATACCCTCTCAGTTTGCAACCGAGGCTTGTT
GGCTTCTCTGTGATGGGCTTGTTTCATCAGGTGTGTTTTTCTGTAGTGGGTTAGCATATGAGATGAGTCA
CTGGCAGTGCACTTACCTGACTCTTACTGGTAGGTAGCTCCTACGCTGGTGTCTGAATAGTCATCTTGAA
AAACTCACTGGGAATAAACGGTGTCCCGTTTTAAGTACTCCACCATCCCATATACATGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 94254. Forward Primer - name:094254_F_cDNA_Gabrb3, sequence:ATGTGAATGCCATAGACAGGTG; Reverse Primer - name:094254_N_SP6_cDNA_Gabrb3, sequence:CCATGTATATGGGATGGTGGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12046 same embryo
 EMAGE:12045 same embryo
 EMAGE:12047 same embryo
 EMAGE:12048 same embryo
 EurExpress:euxassay_008367 same experiment
 MGI:4824965 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS