Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12429

Ifitm7 interferon induced transmembrane protein 7 ( MGI:1921732)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12429 EMAGE:12429 EMAGE:12429 EMAGE:12429 EMAGE:12429
"Pseudo-wholemount" of euxassay_011316. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011316_01 euxassay_011316_02 euxassay_011316_03 euxassay_011316_04
EMAGE:12429 EMAGE:12429 EMAGE:12429 EMAGE:12429 EMAGE:12429
euxassay_011316_05 euxassay_011316_06 euxassay_011316_07 euxassay_011316_08 euxassay_011316_09
EMAGE:12429 EMAGE:12429 EMAGE:12429 EMAGE:12429 EMAGE:12429
euxassay_011316_10 euxassay_011316_11 euxassay_011316_12 euxassay_011316_13 euxassay_011316_14
EMAGE:12429 EMAGE:12429 EMAGE:12429 EMAGE:12429 EMAGE:12429
euxassay_011316_15 euxassay_011316_16 euxassay_011316_17 euxassay_011316_18 euxassay_011316_19
EMAGE:12429 EMAGE:12429 EMAGE:12429 EMAGE:12429
euxassay_011316_20 euxassay_011316_21 euxassay_011316_22 euxassay_011316_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12429Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12429_wholemount_strong.wlz
12429_wholemount_moderate.wlz
12429_wholemount_weak.wlz
12429_wholemount_possible.wlz
12429_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12429_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
regionalstrong expression: see section 13 14 15 16 17
submandibular gland primordium
strong strong
regionalstrong expression: see section 20 moderate expression: see section 08 09 10 11 18 19 21
pancreas
moderate moderate
regionalmoderate expression: see section 11 12 13 14 weak expression: see section 15
epidermis
moderate moderate
single cellmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
stomach glandular region
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 weak expression: see section 04
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 12 17
lower jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 20
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 12
upper jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 20
liver
moderate moderate
single cellmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
seminiferous cord
moderate moderate
regionalmoderate expression: see section 08 09 10 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37745
Entity Detected:Ifitm7, interferon induced transmembrane protein 7 ( MGI:1921732)
Sequence:sense strand is shown

>T37745
GATCAGCATGAGGTGGTTGTAATGGGGACACCCCACACCTCAACTTCTTCGACAACCACCATAATCACCA
TGCCTGAGATCTCCAAGCCTGATTATGTGGTCTGGTCTCTGTTCAATACACTCTTCATGAACTTCTGCTG
CCTGGGTTTCATAGCCTATGCCTACTCTGTGAAGTCTAGGGACAGGAAGATGGTGGGTGATATGACTGGG
GCCCAGGCCTTCGCCTCCACTGCCAGGTGCCTGAACATCAGCTGCCTGATCCTCTCCGTCGTCATGGTCA
TCCTCTTCATCACTTTCTTTGCCACTAGAAGGTAGCCATCTTGTAGCATCTCACAGTAGATAACAGATTC
TGGGGCCTTCCGGGCTTGCTATGTGTTCTATTGTCTATCGCTGTCCCAAACCCTAGTCTTAGTCCTGACC
ATTTACCCCATACATATGCAAATGTTACACTTGCATATCTGTTCATTCAATAAAGTGCATGTGCTGTGGG
AAAAAAAAGAAAAAAAAGAAAAAGCCGGACAGACACTATGGAAGAGTGCTTTCAGTATTTTACAATGAAA
AGATATTTTGAAGAGGGTGCACTTTTGATTCTAAATTCTAAAACACTTCACCACCCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 91564. Forward Primer - name:091564_F_cDNA_Ifitm7, sequence:GATCAGCATGAGGTGGTTGTAA; Reverse Primer - name:091564_N_SP6_cDNA_Ifitm7, sequence:TGGGTGGTGAAGTGTTTTAGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12432 same embryo
 EMAGE:12430 same embryo
 EMAGE:12428 same embryo
 EMAGE:12431 same embryo
 EurExpress:euxassay_011316 same experiment
 MGI:4825521 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS