Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12598

Inpp4a inositol polyphosphate-4-phosphatase, type I ( MGI:1931123)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12598 EMAGE:12598 EMAGE:12598 EMAGE:12598 EMAGE:12598
"Pseudo-wholemount" of euxassay_011291. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011291_01 euxassay_011291_02 euxassay_011291_03 euxassay_011291_04
EMAGE:12598 EMAGE:12598 EMAGE:12598 EMAGE:12598 EMAGE:12598
euxassay_011291_05 euxassay_011291_06 euxassay_011291_07 euxassay_011291_08 euxassay_011291_09
EMAGE:12598 EMAGE:12598 EMAGE:12598 EMAGE:12598 EMAGE:12598
euxassay_011291_10 euxassay_011291_11 euxassay_011291_12 euxassay_011291_13 euxassay_011291_14
EMAGE:12598 EMAGE:12598 EMAGE:12598 EMAGE:12598 EMAGE:12598
euxassay_011291_15 euxassay_011291_16 euxassay_011291_17 euxassay_011291_18 euxassay_011291_19
EMAGE:12598 EMAGE:12598 EMAGE:12598 EMAGE:12598 EMAGE:12598
euxassay_011291_20 euxassay_011291_21 euxassay_011291_22 euxassay_011291_23 euxassay_011291_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12598Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12598_wholemount_strong.wlz
12598_wholemount_moderate.wlz
12598_wholemount_weak.wlz
12598_wholemount_possible.wlz
12598_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12598_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 09 10 17 18
facial vii ganglion
weak weak
regionalweak expression: see section 04 05 06 21
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 08 09 20
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 18 19 20 21 22 23
vagus x ganglion
weak weak
regionalweak expression: see section 09 19
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 07 20
dorsal root ganglion
weak weak
regionalweak expression: see section 11 12 13 14 15 19 20 21 22
maturing glomerular tuft
weak weak
regionalweak expression: see section 11 12 13 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37756
Entity Detected:Inpp4a, inositol polyphosphate-4-phosphatase, type I ( MGI:1931123)
Sequence:sense strand is shown

>T37756
CACAGATTGCATCTGACACTGAGGTCTGCAGAGAGTGACCGTGTCGGCAACATAACTGTGATCGGCTGGC
AGATGGAGGAGAAGTCCGACCAGCAGCCCCCTGTGACCCGGTTTCTGGACACTGTCAATGGAAGGATGGT
TTTGCCCGTTGATGAAAGCTTGACTGAGGCCTTGGGAATCCGATCCAAATATGCTTTTTTGCGAAAAGAC
AGCTTACTGAAAGCAGTGTTTGGTGGTGCCATCTGCCGCATGTACCGCTTCCCAACTACTGATGGTAACC
ACTTACGGATCCTGGAGCAGATGGCAGAGAGCGTCCTCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 91744. Forward Primer - name:091744_F_cDNA_Inpp4a, sequence:CACAGATTGCATCTGACACTGA; Reverse Primer - name:091744_N_SP6_cDNA_Inpp4a, sequence:AGAGGACGCTCTCTGCCATCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12601 same embryo
 EMAGE:12602 same embryo
 EMAGE:12600 same embryo
 EMAGE:12597 same embryo
 EMAGE:12599 same embryo
 EurExpress:euxassay_011291 same experiment
 MGI:4825593 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS