Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12660

Lactb2 lactamase, beta 2 ( MGI:2442551)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12660 EMAGE:12660 EMAGE:12660 EMAGE:12660 EMAGE:12660
"Pseudo-wholemount" of euxassay_011455. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011455_01 euxassay_011455_02 euxassay_011455_03 euxassay_011455_04
EMAGE:12660 EMAGE:12660 EMAGE:12660 EMAGE:12660 EMAGE:12660
euxassay_011455_05 euxassay_011455_06 euxassay_011455_07 euxassay_011455_08 euxassay_011455_09
EMAGE:12660 EMAGE:12660 EMAGE:12660 EMAGE:12660 EMAGE:12660
euxassay_011455_10 euxassay_011455_11 euxassay_011455_12 euxassay_011455_13 euxassay_011455_14
EMAGE:12660 EMAGE:12660 EMAGE:12660 EMAGE:12660 EMAGE:12660
euxassay_011455_15 euxassay_011455_16 euxassay_011455_17 euxassay_011455_18 euxassay_011455_19
EMAGE:12660 EMAGE:12660 EMAGE:12660 EMAGE:12660 EMAGE:12660
euxassay_011455_20 euxassay_011455_21 euxassay_011455_22 euxassay_011455_23 euxassay_011455_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12660Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12660_wholemount_strong.wlz
12660_wholemount_moderate.wlz
12660_wholemount_weak.wlz
12660_wholemount_possible.wlz
12660_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12660_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 21 22 weak expression: see section 09 10 11 12 19 20
olfactory cortex ventricular layer
weak weak
homogeneousweak expression: see section 11 12 17
telencephalon ventricular layer
weak weak
homogeneousweak expression: see section 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22 23 24
midbrain ventricular layer
weak weak
homogeneousweak expression: see section 10 11 12 13 14 15 16
liver lobe
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 weak expression: see section 24
renal cortex
moderate moderate
regionalmoderate expression: see section 10 11 weak expression: see section 12 13 20 21 22 23
lung
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 19 21 22 23 weak expression: see section 17 18 20 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30176
Entity Detected:Lactb2, lactamase, beta 2 ( MGI:2442551)
Sequence:sense strand is shown

>T30176
GAGCAGCTGTCCAGTCGGGTGGTGCGCGTGTTGGGCTGCAACCCGGGTCCCATGACCCTGCAAGGCACCA
ACACGTACCTGGTGGGGACCGGCAGCAGGAGAATCCTCATTGACACTGGCGAGCCTTCAGTTCCAGAATA
TATCAGCTGTTTAAAGCAAGCCTTGGTTGAGTTTGACACAGCAATCCAGGAAATCCTGGTGACACACTGG
CATTCTGATCATTCTGGAGGCATTGTAGACATTTGTAAAAACATCAATAATGACACCACCTACTGCATTA
AAAAACTTCGACGGAATCCCCAGAGAGAAGAAATTATAGGAAATGGAGAACAGCAATTTATTTATATAGA
AAACGGAGACGTGGTTAAGACCGAGGGAGCCACTCTCAGAGTTTTGTACACTCCTGGCCACACTGATGAT
CACATGGCTTTACTCCTGGAGGAGGAGAATGCCATCTTTTCTGGGGACTGCATCCTAGGAGAAGGGACGA
CAATATTTGAAGACCTCTATGATTATATGAACTCCCTAAACAACTTACTAAAAATCAAAGCTAACATTAT
ATATCCAGGACATGGCCCAGTCATCCATAATGCTGAAGCTAAAATTCTGGAATATATTTCTCATAGAAAT
AACCGAGAAGAACAGATTATTTCATTATTCCGTGATAACTTTGAGAAATCATTTACCGTAACGGAACTTA
GGACAATGATTTACAAGGATGTTCCAGAGAATTTACATAAGATGGCAGAGCATAATCTCTTGCTTCATTT
GAGAAAACTAGAGAAAGATGGGAAGATATTCTACACAACAACTCCTGTCAAGAAATGGAAAGCCGTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3496398), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 14152. Forward Primer - name:014152_F_IRAV04-07_F01_Lactb2, sequence:GAGCAGCTGTCCAGTCGG; Reverse Primer - name:014152_R_SP6_IRAV04-07_F01_Lactb2, sequence:GGACGGCTTTCCATTTCTT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12662 same embryo
 EMAGE:12659 same embryo
 EMAGE:12657 same embryo
 EMAGE:12661 same embryo
 EMAGE:12658 same embryo
 EurExpress:euxassay_011455 same experiment
 MGI:4825854 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS