Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12766

Tmem66 transmembrane protein 66 ( MGI:1915137)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12766 EMAGE:12766 EMAGE:12766 EMAGE:12766 EMAGE:12766
"Pseudo-wholemount" of euxassay_011510. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011510_01 euxassay_011510_02 euxassay_011510_03 euxassay_011510_04
EMAGE:12766 EMAGE:12766 EMAGE:12766 EMAGE:12766 EMAGE:12766
euxassay_011510_05 euxassay_011510_06 euxassay_011510_07 euxassay_011510_08 euxassay_011510_09
EMAGE:12766 EMAGE:12766 EMAGE:12766 EMAGE:12766 EMAGE:12766
euxassay_011510_10 euxassay_011510_11 euxassay_011510_12 euxassay_011510_13 euxassay_011510_14
EMAGE:12766 EMAGE:12766 EMAGE:12766 EMAGE:12766 EMAGE:12766
euxassay_011510_15 euxassay_011510_16 euxassay_011510_17 euxassay_011510_18 euxassay_011510_19
EMAGE:12766 EMAGE:12766 EMAGE:12766 EMAGE:12766
euxassay_011510_20 euxassay_011510_21 euxassay_011510_22 euxassay_011510_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12766Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12766_wholemount_strong.wlz
12766_wholemount_moderate.wlz
12766_wholemount_weak.wlz
12766_wholemount_possible.wlz
12766_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12766_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
pituitary gland
strong strong
regionalstrong expression: see section 11 12 13 14 15 16
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 14 15
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 16 17
pons mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 16
vagus x ganglion
strong strong
regionalstrong expression: see section 09 10 19 20
ventral grey horn
moderate moderate
regionalmoderate expression: see section 12 13 16 17 18
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 10 11 12 13 17 18 19 20
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 08 09 10 11 12 14 15 16 17 18 19
vomeronasal organ
strong strong
regionalstrong expression: see section 12 15
lower jaw incisor
strong strong
regionalstrong expression: see section 12 13 16 17
lower jaw molar
strong strong
regionalstrong expression: see section 08 09 19 20
upper jaw incisor
strong strong
regionalstrong expression: see section 11 12 16 17
upper jaw molar
strong strong
regionalstrong expression: see section 08 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30966
Entity Detected:Tmem66, transmembrane protein 66 ( MGI:1915137)
Sequence:sense strand is shown

>T30966
GCACCAGGGCTTCTCTGATTATTATCACAAGCTGTACTCCTCAGATTCCTGTGGCTTTATTACCATTGCA
GTACTGTTTGTTCTCGCCTTTGCGGTTTACAAGCTGTTCCTCAGCGATGGCCAGGGGTCGCCTCCGCCGT
ATTCTGAGCACCCGCCATACTCAGAGCACTCTCAGAGGTTTGCCAGTGCCGCAGGGGCGCCTCCTCCGGG
CTTTAAGTCGGAGTTCACAGGACCACAGAATACTGGCTATGGTGCAAGCTCTGGCTTCGGGAGTGCTTTT
GGAGGCCAAGGCTATGGCAGTTCAGGGCCGGGGTTCTGGTCTGGCCTGGGAGCTGGAGGACTGCTTGGGT
ATTTGTTTGGCAGCAACAGAGCGGCGACGCCTTTCTCAGACTCGTGGTACCATCCAGCCTACCCTCCTTC
CCACTCTGGGGCCTGGAACAGTCGGGCCTACTCACCCCTGGGTGGAGGCGCAGGGAGCTATTGTGCATCC
TCTAATGCAGACTCGAGAACCAGAACAGCATCAGGATATGGTGGCACCAGAAGACGGTAAAATAGGAAAT
TGAAGGCAAACACTGGATGCAAAGTTTCTGATTTGTCATCACCATCTCTTTAACACCTGGCTAATGGGAA
TAACCAAAAGTTGTGTGGTGTTTGGTCCTTGTGTAGCTTTTCGTGTCCCGTTGTTTGTGGCCAAGAGTTG
ATATGTGACAAAATGCTATGGTTTGTATGATAATGTAACATGCAGTTCAAAGCGATGGCCACTGTGGAAT
GCTGACATTGTGCTTGTGTCTCAAGCCTTTCATACCAGAGGGGGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4222385), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 19291. Forward Primer - name:019291_F_IRAV28-31_N01_1810045K07Rik, sequence:GCACCAGGGCTTCTCTGA; Reverse Primer - name:019291_R_SP6_IRAV28-31_N01_1810045K07Rik, sequence:TGCCCCCTCTGGTATGAA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12764 same embryo
 EMAGE:12761 same embryo
 EMAGE:12765 same embryo
 EMAGE:12762 same embryo
 EMAGE:12763 same embryo
 EurExpress:euxassay_011510 same experiment
 MGI:4828814 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS