Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12775

Rundc3a RUN domain containing 3A ( MGI:1858752)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12775 EMAGE:12775 EMAGE:12775 EMAGE:12775 EMAGE:12775
"Pseudo-wholemount" of euxassay_011504. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011504_01 euxassay_011504_02 euxassay_011504_03 euxassay_011504_04
EMAGE:12775 EMAGE:12775 EMAGE:12775 EMAGE:12775 EMAGE:12775
euxassay_011504_05 euxassay_011504_06 euxassay_011504_07 euxassay_011504_08 euxassay_011504_09
EMAGE:12775 EMAGE:12775 EMAGE:12775 EMAGE:12775 EMAGE:12775
euxassay_011504_10 euxassay_011504_11 euxassay_011504_12 euxassay_011504_13 euxassay_011504_14
EMAGE:12775 EMAGE:12775 EMAGE:12775 EMAGE:12775 EMAGE:12775
euxassay_011504_15 euxassay_011504_16 euxassay_011504_17 euxassay_011504_18 euxassay_011504_19
EMAGE:12775 EMAGE:12775 EMAGE:12775 EMAGE:12775 EMAGE:12775
euxassay_011504_20 euxassay_011504_21 euxassay_011504_22 euxassay_011504_23 euxassay_011504_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12775Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12775_wholemount_strong.wlz
12775_wholemount_moderate.wlz
12775_wholemount_weak.wlz
12775_wholemount_possible.wlz
12775_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12775_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
adrenal medulla
moderate moderate
spottedmoderate expression: see section 10 11 12 13 19 20 21
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 19 20 21 22
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 19 20
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 09 19
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 18 20
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 09 16 17
spinal cord
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18 19
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 11 12 17 18
cervical ganglion
moderate moderate
regionalmoderate expression: see section 10 17 18 19
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 14 15 16 17 18
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 22 23 24
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 11 14
tongue
moderate moderate
spottedmoderate expression: see section 11 12 15
stomach
weak weak
spottedweak expression: see section 05 06 07 08 10 11
midgut
weak weak
spottedweak expression: see section 10 11 12 13 14 15 16 17 18 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30364
Entity Detected:Rundc3a, RUN domain containing 3A ( MGI:1858752)
Sequence:sense strand is shown

>T30364
CTGCCCTCCAAGAAAGCATCTTCCCGCAACGTGATCGTGGAGCGCAGGAACCTGATCACCGTGTGCAGGT
TCTCTGTGAAAACCCTGCTAGAGAAGTACACAGCAGAACCCATTGATGACTCTTCCGAGGAGTTTGTTAA
TTTCGCAGCCATTTTAGAGCAGATCCTCAGCCACCGATTTAAAGCTTGTGCCCCAGCAGGGCCAGCGAGC
TGGTTCAGCTCAGATGGACAACGGGGCTTCTGGGACTACATCCGGCTGGCCTGCAGCAAAGTGCCCAACA
ACTGTGTGAGCAGCATTGAGAACATGGAGAACATCAGCACAGCTAGAGCCAAGGGCCGGGCGTGGATCCG
GGTGGCCCTGATGGAGAAGCGTATGTCGGAATACATCACCACAGCTCTTCGGGACAACCGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6391042), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58094. Forward Primer - name:058094_F_IRAV101_d10_Rap2ip, sequence:CTGCCCTCCAAGAAAGCA; Reverse Primer - name:058094_R_SP6_IRAV101_d10_Rap2ip, sequence:TTCGGTTGTCCCGAAGAG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12774 same embryo
 EMAGE:12776 same embryo
 EMAGE:12773 same embryo
 EMAGE:12771 same embryo
 EMAGE:12772 same embryo
 EurExpress:euxassay_011504 same experiment
 MGI:4827834 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS