Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12799

Pea15a phosphoprotein enriched in astrocytes 15A ( MGI:104799)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12799 EMAGE:12799 EMAGE:12799 EMAGE:12799 EMAGE:12799
"Pseudo-wholemount" of euxassay_011580. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011580_01 euxassay_011580_02 euxassay_011580_03 euxassay_011580_04
EMAGE:12799 EMAGE:12799 EMAGE:12799 EMAGE:12799 EMAGE:12799
euxassay_011580_05 euxassay_011580_06 euxassay_011580_07 euxassay_011580_08 euxassay_011580_09
EMAGE:12799 EMAGE:12799 EMAGE:12799 EMAGE:12799 EMAGE:12799
euxassay_011580_10 euxassay_011580_11 euxassay_011580_12 euxassay_011580_13 euxassay_011580_14
EMAGE:12799 EMAGE:12799 EMAGE:12799 EMAGE:12799 EMAGE:12799
euxassay_011580_15 euxassay_011580_16 euxassay_011580_17 euxassay_011580_18 euxassay_011580_19
EMAGE:12799 EMAGE:12799 EMAGE:12799 EMAGE:12799
euxassay_011580_20 euxassay_011580_21 euxassay_011580_22 euxassay_011580_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12799Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12799_wholemount_strong.wlz
12799_wholemount_moderate.wlz
12799_wholemount_weak.wlz
12799_wholemount_possible.wlz
12799_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12799_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus ventricular layer
strong strong
homogeneousstrong expression: see section 11 12 13 14
diencephalon lateral wall ventricular layer
strong strong
homogeneousstrong expression: see section 11 12 13 14
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 10 11 15 16 17
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 14 15 16 17 18 19 20 21 22 23
medulla oblongata basal plate ventricular layer
strong strong
homogeneousstrong expression: see section 11 12 13 14 15
rest of cerebellum ventricular layer
strong strong
homogeneousstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
pons ventricular layer
strong strong
homogeneousstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
midbrain ventricular layer
strong strong
homogeneousstrong expression: see section 09 10 11 12 13 14 15 16 17
ventral grey horn
strong strong
regionalstrong expression: see section 12 13 14 15 16 moderate expression: see section 17 18
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 13 14 15 16
neural retina
strong strong
regionalstrong expression: see section 01 02 03 moderate expression: see section 04 05 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30324
Entity Detected:Pea15a, phosphoprotein enriched in astrocytes 15A ( MGI:104799)
Sequence:sense strand is shown

>T30324
TTCCTCCACTCTTCCCCCACATCTTTATGGAAGCAGAAAGGACCTGCATTTTCCTACACTGAGGAGCTAT
GGTGAAGATGAGGTATGGGAGAGATGGTTGTATCTAAAGAAAACCAGTGGGGAAGGAAGGTAAAGAGGCC
ACTCAACCTCCACCTGGTAAGGGACAAAGAAAAGCCAGGACTCAGTGTTTGTATCTCTATGCTGGACTGG
TTAGAAGCCAGCTTCCTGCTGTTCCCTTAGGCTGAGGTCCTGAGTGCCAATGGGCCCTCCTTATGCCCTT
GTTATGGGCCTGGGATGCGGATGAGCCAGAAATCTTAATGAGAAGACCACTCGATCCTTTCCTGGTCCCA
AAGATCAAACCCCAATGGAGAAGCCAGCATTTACTGTCCCCCAACCTTCTGCTCTGGAGAGACGATGCCG
GGACCATGCACTACTGAGCCTGAGCTAGGGACGCAGGCAGAGACAGGCCCACTTTCTGCTCCTCAGTTTC
TAAATACAGACTGTTGGATAAACTGACCTGGAGCCTAGGGAGATTGGGGGATGAGATCCTTAGGTTTTAA
CCCCAACCTGCCCACAACCTACAGAGTATTGTAGGCAACCTTTCCACTCTCCAGTTTAGAATTCTCCAAG
CAAGTAGTTAATTACAGTGTTTCCTTTGCACTGACCACCACCCTGATTCAATCCAGGAAGGGACTGGTAA
CCTTTCTCATTTGGGTTTGTGGATGCCACACAGTCAAGTCACTAGAGTGCAGTGAGTGAACCCAGCCTCC
TCCCTGTCCCAAGATGCCCTTCCCCATCTTGACCGTGCTAACTGTGTGTACATATATATTCTACATATAT
GTATATTAAACCCGCACTGCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4500957), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 9965. Forward Primer - name:ABA_MGC_050_02_G10_F_GCAGCGTGTCTGATGTGG_ABA_FR_050, sequence:TTCCTCCACTCTTCCCCC; Reverse Primer - name:_R_SP6_ABA_MGC_015_02_B08_TTCCTCCACTCTTCCCCCACATCT, sequence:TGGCAGTGCGGGTTTAAT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12801 same embryo
 EMAGE:12800 same embryo
 EMAGE:12802 same embryo
 EMAGE:12803 same embryo
 EurExpress:euxassay_011580 same experiment
 MGI:4827147 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS