EMAGE mouse gene expression spatial database

EMAGE:12886

Bysl bystin-like ( MGI:1858419)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_011595. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_011595_01	euxassay_011595_02	euxassay_011595_03	euxassay_011595_04

euxassay_011595_05	euxassay_011595_06	euxassay_011595_07	euxassay_011595_08	euxassay_011595_09

euxassay_011595_10	euxassay_011595_11	euxassay_011595_12	euxassay_011595_13	euxassay_011595_14

euxassay_011595_15	euxassay_011595_16	euxassay_011595_17	euxassay_011595_18	euxassay_011595_19

euxassay_011595_20	euxassay_011595_21	euxassay_011595_22	euxassay_011595_23	euxassay_011595_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T31042
Entity Detected:	Bysl, bystin-like ( MGI:1858419)
Sequence:	sense strand is shown >T31042 ACGTGTGAACCTGGTGGGCAATTTTTTCGGCCAAAATGCCCAAATTCAAGGTGACACGTGGGGCCAGCAA TCGGGAGAAGCATGCACCTCTGGCCGAGCAGATCCTGGCTGGGAACGCAGTGCGCGCGGGGACCCGAGAA AAACGGCGGGGGCGTGAGGTCGAAGAGGAGGAAGAGTATGTGGGACCCCGGCTAAGCAGACGGATTTTGC AGCAAGCCAGACAACAGCAGGAGGAGCTCGAAACTGACCATGGGGCTGGTGATCGGTCAGCACCACCGCG AGAGCGCGCCACGCGGCTGGGGCCGGGATTGCCACAGGATGGATCAGATGAGGAGGATGAGGAGTGGCCT ACCCTGGAGAAGGCAGCCAA
Notes:	The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4925307), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 20975. Forward Primer - name:020975_F_IRAV36-39_K24_Bysl, sequence:ACGTGTGAACCTGGTGGG; Reverse Primer - name:020975_R_SP6_IRAV36-39_K24_Bysl, sequence:TTTGGCTGCCTTCTCCAG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:12883 same embryo
	EMAGE:12884 same embryo
	EMAGE:12885 same embryo
	EurExpress:euxassay_011595 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source