Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13610

Mir452 microRNA 452 ( MGI:3619450)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13610 EMAGE:13610 EMAGE:13610 EMAGE:13610 EMAGE:13610
"Pseudo-wholemount" of euxassay_019181. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019181_01 euxassay_019181_02 euxassay_019181_03 euxassay_019181_04
EMAGE:13610 EMAGE:13610 EMAGE:13610 EMAGE:13610 EMAGE:13610
euxassay_019181_05 euxassay_019181_06 euxassay_019181_07 euxassay_019181_08 euxassay_019181_09
EMAGE:13610 EMAGE:13610 EMAGE:13610 EMAGE:13610 EMAGE:13610
euxassay_019181_10 euxassay_019181_11 euxassay_019181_12 euxassay_019181_13 euxassay_019181_14
EMAGE:13610 EMAGE:13610 EMAGE:13610 EMAGE:13610 EMAGE:13610
euxassay_019181_15 euxassay_019181_16 euxassay_019181_17 euxassay_019181_18 euxassay_019181_19
EMAGE:13610 EMAGE:13610 EMAGE:13610 EMAGE:13610
euxassay_019181_20 euxassay_019181_21 euxassay_019181_22 euxassay_019181_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13610Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13610_wholemount_strong.wlz
13610_wholemount_moderate.wlz
13610_wholemount_weak.wlz
13610_wholemount_possible.wlz
13610_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13610_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 weak expression: see section 06 07
telencephalon
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 weak expression: see section 01 02 03 04 05 06 07
hindbrain
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20 weak expression: see section 04 05 06 07
midbrain
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 weak expression: see section 05 06 07
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 20 weak expression: see section 05
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 18 weak expression: see section 06
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 08 17 18 19 20 21 22 weak expression: see section 03 05 06 07
spinal cord
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 14 15 16 17 18
neural retina
weak weak
regionalweak expression: see section 01 02 03 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70033
Entity Detected:Mir452, microRNA 452 ( MGI:3619450)
Sequence:sense strand is shown

>T70033
TGTTTGCAGAGGAAACTGAGAC
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-452 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13611 same embryo
 EurExpress:euxassay_019181 same experiment
 MGI:4826292 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS