Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13734

Snw1 SNW domain containing 1 ( MGI:1913604)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13734 EMAGE:13734 EMAGE:13734 EMAGE:13734 EMAGE:13734
"Pseudo-wholemount" of euxassay_019554. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019554_01 euxassay_019554_02 euxassay_019554_03 euxassay_019554_04
EMAGE:13734 EMAGE:13734 EMAGE:13734 EMAGE:13734 EMAGE:13734
euxassay_019554_05 euxassay_019554_06 euxassay_019554_07 euxassay_019554_08 euxassay_019554_09
EMAGE:13734 EMAGE:13734 EMAGE:13734 EMAGE:13734 EMAGE:13734
euxassay_019554_10 euxassay_019554_11 euxassay_019554_12 euxassay_019554_13 euxassay_019554_14
EMAGE:13734 EMAGE:13734 EMAGE:13734 EMAGE:13734 EMAGE:13734
euxassay_019554_15 euxassay_019554_16 euxassay_019554_17 euxassay_019554_18 euxassay_019554_19
EMAGE:13734 EMAGE:13734 EMAGE:13734 EMAGE:13734 EMAGE:13734
euxassay_019554_20 euxassay_019554_21 euxassay_019554_22 euxassay_019554_23 euxassay_019554_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13734Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13734_wholemount_strong.wlz
13734_wholemount_moderate.wlz
13734_wholemount_weak.wlz
13734_wholemount_possible.wlz
13734_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13734_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
axial musculature
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 06 07 08 10 11 12
thymus primordium
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 19 20 21 22 23
pancreas
weak weak
regionalweak expression: see section 12 13 14 15
thyroid gland
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 18 19
vibrissa
moderate moderate
regionalmoderate expression: see section 06 07 08 20 21 22
olfactory cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 weak expression: see section 16
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 weak expression: see section 12 14 15 16 17 18 19 20 21 22 23 24
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 10 18 19 weak expression: see section 11
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 18 19 20 21 weak expression: see section 05 07 08 09 13 14 15 16 17
pons mantle layer
weak weak
regionalweak expression: see section 08 19
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15 16 weak expression: see section 11 12 17 18
midgut
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16 17 18 19 20
metanephros
moderate moderate
regionalmoderate expression: see section 09 10 11 20 21 22 23 24 weak expression: see section 12 13 14
testis
moderate moderate
regionalmoderate expression: see section 08 09 10 11 22 23 24
lung
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55181
Entity Detected:Snw1, SNW domain containing 1 ( MGI:1913604)
Sequence:sense strand is shown

>T55181
ATGTGGCCCAGTATCCTCTGGATATGGGGCGAAAGAAAAAAATGTCGAATGCTCTGGCCATTCAGGTGGA
TCCTGAAGGGAAAATTAAGTATGATGCAATTGCTCGGCAGGGACAGTCCAAAGACAAGGTCATTTACAGC
AAATACACTGACCTGGTTCCTAAGGAGGTTATGAATGCAGATGACCCAGACCTGCAACGGCCCGATGAAG
AGGCAATTAAAGAGATAACAGAAAAGACTAGAGTTGCCTTGGAGAAATCTGTGTCGCAGAAGGTTGCTGC
AGCCATGCCAGTTCGTGCAGCTGACAAGCTGGCTCCTGCTCAGTATATCCGCTACACACCATCTCAGCAA
GGAGTAGCATTCAATTCTGGAGCTAAACAGAGGGTCATTCGGATGGTAGAAATGCAGAAAGACCCAATGG
AGCCTCCAAGATTCAAGATTAATAAGAAAATTCCCCGGGGACCACCGTCTCCTCCTGCACCTGTAATGCA
CTCTCCTAGTCGGAAGATGACTGTAAAGGAACAACAAGAGTGGAAGATCCCGCCTTGTATTTCCAACTGG
AAGAACGCTAAGGGGTATACGATCCCATTAGATAAACGGCTGGCTGCTGATGGAAGAGGACTTCAGACTG
TCCACATAAATGAAAATTTTGCCAAACTGGCTGAAGCGCTCTACATTGCTGATCGGAAGGCTCGTGAAGC
GGTGGAAATGCGAGCCCAGGTAGAGAGAAAGATGGCTCAAAAAGAAAAGGAGAAACATGAAGAGAAACTT
AGAGAAATGGCCCAGAAAGCCAGAGAAAGGAGAGCTGGAATCAAAACCCACGTGGAGAAAGAGGATGGAG
AGGCCCGTGAGAGAGATGAAATCCGTCATGACAGGCGAAAAGAGAGACAGCATGACCGGAAC
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:ATGTGGCCCAGTATCCTCTG; Reverse Primer - name:unspecified, sequence:GTTCCGGTCATGCTGTCTCT. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13736 same embryo
 EMAGE:13735 same embryo
 EMAGE:13732 same embryo
 EMAGE:13731 same embryo
 EMAGE:13733 same embryo
 EurExpress:euxassay_019554 same experiment
 MGI:4828362 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS