Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13815

Six3 sine oculis-related homeobox 3 homolog (Drosophila) ( MGI:102764)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13815 EMAGE:13815 EMAGE:13815 EMAGE:13815 EMAGE:13815
"Pseudo-wholemount" of euxassay_019625. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019625_01 euxassay_019625_02 euxassay_019625_03 euxassay_019625_04
EMAGE:13815 EMAGE:13815 EMAGE:13815 EMAGE:13815 EMAGE:13815
euxassay_019625_05 euxassay_019625_06 euxassay_019625_07 euxassay_019625_08 euxassay_019625_09
EMAGE:13815 EMAGE:13815 EMAGE:13815 EMAGE:13815 EMAGE:13815
euxassay_019625_10 euxassay_019625_11 euxassay_019625_12 euxassay_019625_13 euxassay_019625_14
EMAGE:13815 EMAGE:13815 EMAGE:13815 EMAGE:13815 EMAGE:13815
euxassay_019625_15 euxassay_019625_16 euxassay_019625_17 euxassay_019625_18 euxassay_019625_19
EMAGE:13815 EMAGE:13815 EMAGE:13815 EMAGE:13815
euxassay_019625_20 euxassay_019625_21 euxassay_019625_22 euxassay_019625_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13815Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13815_wholemount_strong.wlz
13815_wholemount_moderate.wlz
13815_wholemount_weak.wlz
13815_wholemount_possible.wlz
13815_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13815_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
pituitary gland
strong strong
regionalstrong expression: see section 12 13 moderate expression: see section 10 11 14 15
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 09 10 11 14 15 moderate expression: see section 16
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 12 13
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 13 14 15 16 17 18 weak expression: see section 06
corpus striatum
strong strong
regionalstrong expression: see section 07 18 19 20 21 22 23 moderate expression: see section 06 08 17 weak expression: see section 03 04 05
telencephalon mantle layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 15
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 12 13
midbrain mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 17 18 19 20 moderate expression: see section 09 14 16
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 04 05 19 20 21 22 weak expression: see section 06 07 08 17 18
ventral grey horn
moderate moderate
single cellmoderate expression: see section 10 11 12 13 14 15
dorsal root ganglion
strong strong
single cellstrong expression: see section 08 16 17 18 moderate expression: see section 09 10
neural retina
strong strong
regionalstrong expression: see section 01 02 03 22 23
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 17 18 19 moderate expression: see section 07 08 09 10 11 12 13 14 15 16
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55175
Entity Detected:Six3, sine oculis-related homeobox 3 homolog (Drosophila) ( MGI:102764)
Sequence:sense strand is shown

>T55175
GCGGCCGCCCGCTCGGCCCGGTGGACAAGTACCGCGTGCGCAAGAAGTTCCCTCTGCCGCGCACCATCTG
GGATGGCGAGCAGAAGACCCATTGCTTCAAGGAGCGGACTCGGAGCCTGCTGCGGGAGTGGTACCTGCAG
GATCCCTACCCCAACCCCAGCAAGAAACGCGAACTGGCGCAGGCCACCGGCCTCACCCCCACACAAGTAG
GCAACTGGTTTAAGAACCGGCGACAGCGCGACCGCGCAGCGGCGGCCAAGAACAGGCTCCAGCATCAGGC
CATCGGGCCGAGCGGGATGCGCTCGCTGGCCGAGCCCGGCTGCCCCACGCACGGCTCAGCAGAGTCACCG
TCCACGGCGGCCAGCCCGACCACCAGTGTGTCCAGCCTGACGGAGCGCGCGGACACCGGCACTTCGATCC
TCTCGGTAACCTCCAGCGACTCGGAATGTGATGTATGATAGCCAAGGCCGCCCTACTCCTCCCCCTCCTC
CCCTTCCACCTTCCCCTCCTCTTCGTAACCCTGCTCCTCTTCCTCTTCTTCTACTCCATCCCTAGAACAA
ACCGAAATCAGGATACACAGACAGATACACACACAAGTCCATACACACTCCCACCCCAGCCAAAAAA
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:unspecified; Reverse Primer - name:unspecified, sequence:unspecified. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13816 same embryo
 EMAGE:13814 same embryo
 EurExpress:euxassay_019625 same experiment
 MGI:4828081 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS