Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13869

Mir412 microRNA 412 ( MGI:3619400)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13869 EMAGE:13869 EMAGE:13869 EMAGE:13869 EMAGE:13869
"Pseudo-wholemount" of euxassay_019268. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019268_01 euxassay_019268_02 euxassay_019268_03 euxassay_019268_04
EMAGE:13869 EMAGE:13869 EMAGE:13869 EMAGE:13869 EMAGE:13869
euxassay_019268_05 euxassay_019268_06 euxassay_019268_07 euxassay_019268_08 euxassay_019268_09
EMAGE:13869 EMAGE:13869 EMAGE:13869 EMAGE:13869 EMAGE:13869
euxassay_019268_10 euxassay_019268_11 euxassay_019268_12 euxassay_019268_13 euxassay_019268_14
EMAGE:13869 EMAGE:13869 EMAGE:13869 EMAGE:13869 EMAGE:13869
euxassay_019268_15 euxassay_019268_16 euxassay_019268_17 euxassay_019268_18 euxassay_019268_19
EMAGE:13869 EMAGE:13869 EMAGE:13869 EMAGE:13869 EMAGE:13869
euxassay_019268_20 euxassay_019268_21 euxassay_019268_22 euxassay_019268_23 euxassay_019268_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13869Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13869_wholemount_strong.wlz
13869_wholemount_moderate.wlz
13869_wholemount_weak.wlz
13869_wholemount_possible.wlz
13869_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13869_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
mandible
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 17 18 19 20 21 22 23
maxilla
moderate moderate
regionalmoderate expression: see section 06 11 17 18 19
temporal bone
weak weak
regionalweak expression: see section 01 02 03 04 05 20 21
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 02 03 04 23 24 weak expression: see section 01 05 06 07 08 09 19 20 21
viscerocranium
weak weak
regionalExpression in the turbinate bone.
clavicle
moderate moderate
regionalmoderate expression: see section 08 09 10 17 18 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70014
Entity Detected:Mir412, microRNA 412 ( MGI:3619400)
Sequence:sense strand is shown

>T70014
TTCACCTGGTCCACTAGCCG
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-412 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13868 same embryo
 EurExpress:euxassay_019268 same experiment
 MGI:4826281 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS