Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13881

Grb7 growth factor receptor bound protein 7 ( MGI:102683)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13881 EMAGE:13881 EMAGE:13881 EMAGE:13881 EMAGE:13881
"Pseudo-wholemount" of euxassay_007755. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007755_01 euxassay_007755_02 euxassay_007755_03 euxassay_007755_04
EMAGE:13881 EMAGE:13881 EMAGE:13881 EMAGE:13881 EMAGE:13881
euxassay_007755_05 euxassay_007755_06 euxassay_007755_07 euxassay_007755_08 euxassay_007755_09
EMAGE:13881 EMAGE:13881 EMAGE:13881 EMAGE:13881 EMAGE:13881
euxassay_007755_10 euxassay_007755_11 euxassay_007755_12 euxassay_007755_13 euxassay_007755_14
EMAGE:13881 EMAGE:13881 EMAGE:13881 EMAGE:13881 EMAGE:13881
euxassay_007755_15 euxassay_007755_16 euxassay_007755_17 euxassay_007755_18 euxassay_007755_19
EMAGE:13881 EMAGE:13881 EMAGE:13881 EMAGE:13881
euxassay_007755_20 euxassay_007755_21 euxassay_007755_22 euxassay_007755_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13881Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13881_wholemount_strong.wlz
13881_wholemount_moderate.wlz
13881_wholemount_weak.wlz
13881_wholemount_possible.wlz
13881_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13881_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 12 13 14 15
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 16 17 18
thyroid gland
weak weak
regionalweak expression: see section 11 15 16
pituitary gland
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
vibrissa
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 18 19
inner ear
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 17 19 weak expression: see section 18
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 16 17 19 23 weak expression: see section 18
eyelid
moderate moderate
regionalmoderate expression: see section 01 03 04 05 23 weak expression: see section 02 22
anterior naris
moderate moderate
regionalmoderate expression: see section 12 13 15 16
external naris
moderate moderate
regionalmoderate expression: see section 12 15
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 15 16 17 18
naso-lacrimal duct
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 18 19 20 21 23
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 12 15
esophagus epithelium
moderate moderate
regionalmoderate expression: see section 13
pharynx epithelium
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
stomach
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10
rectum
strong strong
regionalstrong expression: see section 11
midgut
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 12 14 16 17
lower jaw molar
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 18
oral epithelium
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 16 17
upper jaw molar
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 19
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 23
urinary system
strong strong
regionalstrong expression: see section 03 04 05 11
bladder
strong strong
regionalstrong expression: see section 11 12
kidney calyx
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 16 17 18 19
ureter
strong strong
regionalstrong expression: see section 10 12 13 14 15
ovary
strong strong
regionalstrong expression: see section 07 08 09 10
larynx
moderate moderate
regionalmoderate expression: see section 13
left lung
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12
right lung
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19 23
trachea
moderate moderate
regionalmoderate expression: see section 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1369
Entity Detected:Grb7, growth factor receptor bound protein 7 ( MGI:102683)
Sequence:sense strand is shown

>T1369
CCTCGAGNCTGTTGGCCTACTGGGTCCAGCCTGTTCTCTCCGGGGCACCTGCTCTCTCTCTCTCTCTCCC
TCTCTCCTAGCACCTGCTGCTCAGTAGGAAGGGCAAGAGCAATTCGAGGCGGTGCATTGTGAGGAGTCTC
CACCCCTCCTCCTGCGCTTCCTTCTCCAGGGAGCCTCTCAGGCTCCGCCCTTACCTGCCCGAGATAATTT
TAGTTTCCCTGGGCCTGGAATCTGGATACGCAGGGCTCGCTCTATATTCTCCCGCCTCAACATTCCAAAG
GCGGGATAGCCTTTCTACCATCTGTAGAGAAGAGAGAAAGGATTCGAAATCAAATCTAAGTGTCTGGGAT
CTCTAGACAGAGCCAGACTTTGGGCCGGGTGTCCGGCTCCTTCTGTTGGAGGTGCTCCAGGTGCCATGGA
ACTGGATCTGAGCCCGACTCATCTCAGCAGCTCCCCAGAAGATGTGTGCCCAACTCCTGCTACCCCTCCT
GAGACTCCTCCGCCCCCTGATAACCCTCCGCCAGGGGATGTGAAGCGGTCGCAGCCTTTGCCCATCCCCA
GCAGCAGGGAACTTCGAGAAGAGGAGT
Notes:The probe template was PCR amplified from IMAGE:2317922 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2317922 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13884 same embryo
 EMAGE:13883 same embryo
 EMAGE:13882 same embryo
 EMAGE:13885 same embryo
 EMAGE:13886 same embryo
 EurExpress:euxassay_007755 same experiment
 MGI:4825217 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS