Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13887

Cited1 Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 1 ( MGI:108023)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13887 EMAGE:13887 EMAGE:13887 EMAGE:13887 EMAGE:13887
"Pseudo-wholemount" of euxassay_007770. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007770_01 euxassay_007770_02 euxassay_007770_03 euxassay_007770_04
EMAGE:13887 EMAGE:13887 EMAGE:13887 EMAGE:13887 EMAGE:13887
euxassay_007770_05 euxassay_007770_06 euxassay_007770_07 euxassay_007770_08 euxassay_007770_09
EMAGE:13887 EMAGE:13887 EMAGE:13887 EMAGE:13887 EMAGE:13887
euxassay_007770_10 euxassay_007770_11 euxassay_007770_12 euxassay_007770_13 euxassay_007770_14
EMAGE:13887 EMAGE:13887 EMAGE:13887 EMAGE:13887 EMAGE:13887
euxassay_007770_15 euxassay_007770_16 euxassay_007770_17 euxassay_007770_18 euxassay_007770_19
EMAGE:13887 EMAGE:13887 EMAGE:13887 EMAGE:13887
euxassay_007770_20 euxassay_007770_21 euxassay_007770_22 euxassay_007770_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13887Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13887_wholemount_strong.wlz
13887_wholemount_moderate.wlz
13887_wholemount_weak.wlz
13887_wholemount_possible.wlz
13887_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13887_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 20 21 22 23
upper leg muscle
strong strong
regionalstrong expression: see section 01 02 03 04 14 15 16 17 18 19 20
forearm rest of mesenchyme
strong strong
regionalstrong expression: see section 01
hand
strong strong
regionalstrong expression: see section 02
foot
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 14 15 16 17 18
lower leg rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 18 19 20 21 22 23
axial muscle
strong strong
regionalstrong expression: see section 05 06 07 08 09
cranial muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 08 09 10 13 14 15 16 17 18 19 20 21 22 23
pectoral girdle and thoracic body wall muscle
strong strong
regionalstrong expression: see section 15 16 17 18 19 20 21
pancreas
strong strong
regionalstrong expression: see section 09 10 13 15 moderate expression: see section 08
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 07 08 13 15
telencephalon mantle layer
strong strong
regionalstrong expression: see section 08 09 11 12
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 09 10 14 15
pons mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 17 18
endocardial tissue
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
liver
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
renal cortex
strong strong
regionalstrong expression: see section 06 07 08 09 10 15 16 17 18
tail mesenchyme
strong strong
regionalstrong expression: see section 13 14
tail paraxial mesenchyme
strong strong
regionalstrong expression: see section 07 08 09 10 11 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1382
Entity Detected:Cited1, Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 1 ( MGI:108023)
Sequence:sense strand is shown

>T1382
TCGAGACTGTTGGCCTACTGGAGACGCGAGGAAGGCACAGCACCCACTCGGGCCCTCCACCAACAGGCCC
AGCTGGCGGCATCAACTGCCACCGATTTATCGGACTTCTGCCCAGGCTCTGAAATGCCAACTATGTCGAG
GCCTGCACTTGATGTCAAGGGTGGCACCACCTCTGGGAAGGAGGATGTCAACCAGGAGATGAACTCTCTG
GCCTACTCCAACCTTGGAGTGAAGGATCTCAAGGCAGTGACTGTCCTGCACTACCCCGGGGTCACCGCAA
ATGGAGCCAAAGCCAACGGAGTTCCCACTAGCTCCTCTGGATCGACATCTCCAATAGGCTCTCCTACTGC
CACCCCTTCTTCCAAACCCCCATCCTTCAACCTGCATCCTACCCCTCACCTGATGGCCAGCATGCAGCTT
CAGAAGCTTAATAGCCAGTACCAAGGGGCTGCGGCTACTGCTGCTGCTGCCCTCACTGGTGCAGGCCTAC
CAGGGGAGGAAGAGCCCATGCAAAACTGGGTCACCGCCCCTCTGGTAGTGGGAGGGTCTCCGGGATCTGT
C
Notes:The probe template was PCR amplified from IMAGE:2332257 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2332257 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13889 same embryo
 EMAGE:13888 same embryo
 EurExpress:euxassay_007770 same experiment
 MGI:4823884 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS