Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13931

Ren2 renin 2 tandem duplication of Ren1 ( MGI:97899)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13931 EMAGE:13931 EMAGE:13931 EMAGE:13931 EMAGE:13931
"Pseudo-wholemount" of euxassay_007869. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007869_01 euxassay_007869_02 euxassay_007869_03 euxassay_007869_04
EMAGE:13931 EMAGE:13931 EMAGE:13931 EMAGE:13931 EMAGE:13931
euxassay_007869_05 euxassay_007869_06 euxassay_007869_07 euxassay_007869_08 euxassay_007869_09
EMAGE:13931 EMAGE:13931 EMAGE:13931 EMAGE:13931 EMAGE:13931
euxassay_007869_10 euxassay_007869_11 euxassay_007869_12 euxassay_007869_13 euxassay_007869_14
EMAGE:13931 EMAGE:13931 EMAGE:13931 EMAGE:13931 EMAGE:13931
euxassay_007869_15 euxassay_007869_16 euxassay_007869_17 euxassay_007869_18 euxassay_007869_19
EMAGE:13931 EMAGE:13931
euxassay_007869_20 euxassay_007869_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13931Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13931_wholemount_strong.wlz
13931_wholemount_moderate.wlz
13931_wholemount_weak.wlz
13931_wholemount_possible.wlz
13931_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13931_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
weak weak
regionalweak expression: see section 13 14 15 16 17 18 19 20
anterior abdominal wall musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 13 14 15 16 17 18 20 21 weak expression: see section 19
axial musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 13 14 15 16 17 18
adrenal gland
strong strong
regionalstrong expression: see section 07 13 14 15
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 09 moderate expression: see section 12 13
pons mantle layer
strong strong
regionalstrong expression: see section 07 10 11
esophagus
moderate moderate
regionalmoderate expression: see section 07 08 09 10
renal cortex
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17
testis
strong strong
regionalstrong expression: see section 05 06 15 16 17
clavicle
weak weak
regionalweak expression: see section 11 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1400
Entity Detected:Ren2, renin 2 tandem duplication of Ren1 ( MGI:97899)
Sequence:sense strand is shown

>T1400
TCCTCGAGNCTGTTGGCCTACTGGACAGCTCTTAGAAAGCCTTGGCTGAACCAGATGGACAGAAGGAGGA
TGCCTCTCTGGGCACTCTTGTTGCTCTGGAGTCCTTGCACCTTCAGTCTCCCAACACGCACCGCTACCTT
TGAACGAATCCCGCTCAAGAAAATGCCTTCTGTCCGGGAAATCCTGGAGGAGCGGGGAGTGGACATGACC
AGGCTCAGTGCTGAATGGGGCGTATTCACAAAGAGGCCTTCCTTGACCAATCTTACCTCCCCCGTGGTCC
TCACCAACTACCTGAATACCCAGTACTACGGCGAGATTGGCATCGGTACCCCACCCCAGACCTTCAAAGT
CATCTTTGACACGGGTTCAGCCAACCTCTGGGTGCCCCCCACCAAGTGCAGCCGCCTCTACCTTGCTTGT
GGGATTCACAGCCTCTATGAGTCCTCTGACTCCTCCAGCTACATGGAGAACGGGTCCGACTTCACCATCC
ACTACGGATCAGGGAGAGTCAAAGGTTTCCTCAGCCAGGACTCGGTGACTGTGGGTGGAATCACTGTGAC
ACAGACCTTT
Notes:The probe template was PCR amplified from IMAGE:2372778 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2372778 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13930 same assay
 EMAGE:13933 same embryo
 EurExpress:euxassay_007869 same experiment
 EMAGE:13932 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS