Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14026

Ppp1r1a protein phosphatase 1, regulatory (inhibitor) subunit 1A ( MGI:1889595)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14026 EMAGE:14026 EMAGE:14026 EMAGE:14026 EMAGE:14026
"Pseudo-wholemount" of euxassay_001697. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001697_01 euxassay_001697_02 euxassay_001697_03 euxassay_001697_04
EMAGE:14026 EMAGE:14026 EMAGE:14026 EMAGE:14026 EMAGE:14026
euxassay_001697_05 euxassay_001697_06 euxassay_001697_07 euxassay_001697_08 euxassay_001697_09
EMAGE:14026 EMAGE:14026 EMAGE:14026 EMAGE:14026 EMAGE:14026
euxassay_001697_10 euxassay_001697_11 euxassay_001697_12 euxassay_001697_13 euxassay_001697_14
EMAGE:14026 EMAGE:14026 EMAGE:14026 EMAGE:14026 EMAGE:14026
euxassay_001697_15 euxassay_001697_16 euxassay_001697_17 euxassay_001697_18 euxassay_001697_19
EMAGE:14026 EMAGE:14026
euxassay_001697_20 euxassay_001697_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14026Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14026_wholemount_strong.wlz
14026_wholemount_moderate.wlz
14026_wholemount_weak.wlz
14026_wholemount_possible.wlz
14026_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14026_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon
weak weak
homogeneousweak expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 19 20 weak expression: see section 21
olfactory cortex marginal layer
moderate moderate
regionalmoderate expression: see section 12 13 14 18 19
olfactory cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13 18 19
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 17 18 19 20 weak expression: see section 21
hindbrain
weak weak
homogeneousweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain
weak weak
homogeneousweak expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 04 15
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 16 17 18 19 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 05
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 07 moderate expression: see section 04 05 15 16 17
spinal cord
weak weak
homogeneousweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 09 10 11 12 13
neural retina
weak weak
regionalweak expression: see section 01 02 03 04 05 21
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 09 10 11 12 13 15 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3116
Entity Detected:Ppp1r1a, protein phosphatase 1, regulatory (inhibitor) subunit 1A ( MGI:1889595)
Sequence:sense strand is shown

>T3116
TGGCCTCGAGGCCAGATTCGGACGAGGGAGGGAGCGCGCCCGCCCCAGCCCGAGGTCCGCCGCTGCCTGA
CCGGGAGCCATGGAGCCCGACAACAGCCCACGGAAGATCCAGTTTACGGTCCCGCTGCTGGAGCCTCACC
TGGACCCGGAGGCGGCGGAGCAGATTCGGAGGCGCCGCCCCACCCCTGCCACACTTGTGCTGACCAGTGA
TCAGTCCTCCCCAGAAATAGATGAAGACCGGATCCCCAACTCACTTCTCAAGTCCACCTTGTCAATGTCT
CCACGGCAACGGAAGAAGATGACAAGGACCACACCCACCATGAAAGAGCTCCAGACGATGGTTGAACATC
ACCTAGGGCAACAGAAGCAAGGGGAAGAACCTGAGGGAGCCACTGAGAGCACAGGGAACCAGGAGTCCTG
CCCACCTGGGATCCCAGACACAGGCTCGGCGTCAAGGCCAGATACCCCCGGGACAGCACAAAAGTCTGCA
GAATCCAACCCCAAGACTCAGGAGCAGTGTGGTGTGGAGCCCAGAACAGAGGATTCTTCAG
Notes:The probe template was PCR amplified from IMAGE:1547348 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1547348 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14028 same embryo
 EMAGE:14027 same embryo
 EMAGE:14025 same embryo
 EurExpress:euxassay_001697 same experiment
 MGI:4827372 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS