Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14072

Fam198b family with sequence similarity 198, member B ( MGI:1915909)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14072 EMAGE:14072 EMAGE:14072 EMAGE:14072 EMAGE:14072
"Pseudo-wholemount" of euxassay_001747. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001747_01 euxassay_001747_02 euxassay_001747_03 euxassay_001747_04
EMAGE:14072 EMAGE:14072 EMAGE:14072 EMAGE:14072 EMAGE:14072
euxassay_001747_05 euxassay_001747_06 euxassay_001747_07 euxassay_001747_08 euxassay_001747_09
EMAGE:14072 EMAGE:14072 EMAGE:14072 EMAGE:14072 EMAGE:14072
euxassay_001747_10 euxassay_001747_11 euxassay_001747_12 euxassay_001747_13 euxassay_001747_14
EMAGE:14072 EMAGE:14072 EMAGE:14072 EMAGE:14072 EMAGE:14072
euxassay_001747_15 euxassay_001747_16 euxassay_001747_17 euxassay_001747_18 euxassay_001747_19
EMAGE:14072 EMAGE:14072 EMAGE:14072
euxassay_001747_20 euxassay_001747_21 euxassay_001747_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14072Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14072_wholemount_strong.wlz
14072_wholemount_moderate.wlz
14072_wholemount_weak.wlz
14072_wholemount_possible.wlz
14072_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14072_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 08 09 10 16 17 18 19
cervical intervertebral disc
moderate moderate
regionalmoderate expression: see section 07 08 15 16
lumbar intervertebral disc
moderate moderate
regionalmoderate expression: see section 15
head mesenchyme
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
body-wall mesenchyme
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
adrenal gland
weak weak
homogeneousweak expression: see section 08 09 15 16 17
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14
ventral grey horn
strong strong
regionalstrong expression: see section 13
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 11
heart ventricle
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
cervical vertebra
moderate moderate
regionalmoderate expression: see section 07 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2763
Entity Detected:Fam198b, family with sequence similarity 198, member B ( MGI:1915909)
Sequence:sense strand is shown

>T2763
GGCCTCGAGCCAGATTCGGCACGAGGGCAATTAGGTTTCATCTGATTTAACTGATATTATCTAGGTATTG
ACGATAAGTTCAGATATTAAATATATTATGTAGATCAGCTCAATACAAGAAGTCCTAATGAAAGCCAACA
CTCATGACTGCATCTTCTCACAAAGAACATGGATAGAGAGCATATGGCAACTAATTAGGCAAAATTAAGT
CTCAACTAATTCTCCCCCAAATCCCTCTACCAAACCTTTCGTGGGCTTGGAGGAACTAAGGCACACAAAG
TTCATGCTCTGAGTCTTTCTGTCCTGAGAGAATTTGCCAGGCCATCACTTATCCTTCTTATACGGAACCT
TTGAATCTAGAGCAAATTCTGTCTCTCTTGCTTTCAGCTCTACTACCGCTTATTTGCAAGGTCATTGATT
AGCCAGGTGTAGTGATACAGACCTGAAATCCTAGCACCCAGGAAGCCGTGGACGGTTTGCAAGTCTGATG
TCAGTCTGGTGTTAGTGATAACCTGTCTGAAATGTGCCTCTCCCTTCATAAAAACTGATTTACTGACTTT
TTCTTCTT
Notes:The probe template was PCR amplified from IMAGE:1514657 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1514657 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14071 same embryo
 EMAGE:14073 same embryo
 EurExpress:euxassay_001747 same experiment
 MGI:4824735 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS