EMAGE mouse gene expression spatial database

EMAGE:14474

Bola1 bolA-like 1 (E. coli) ( MGI:1916418)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_005372. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_005372_01	euxassay_005372_02	euxassay_005372_03	euxassay_005372_04

euxassay_005372_05	euxassay_005372_06	euxassay_005372_07	euxassay_005372_08	euxassay_005372_09

euxassay_005372_10	euxassay_005372_11	euxassay_005372_12	euxassay_005372_13	euxassay_005372_14

euxassay_005372_15	euxassay_005372_16	euxassay_005372_17	euxassay_005372_18	euxassay_005372_19

euxassay_005372_20	euxassay_005372_21	euxassay_005372_22

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T8313
Entity Detected:	Bola1, bolA-like 1 (E. coli) ( MGI:1916418)
Sequence:	sense strand is shown >T8313 GGTGGTACAGCAGGCTGCGCAGCAAGTACAAAGCGAATGCTAAGTGCGCGATCGGCCCAGTGCATGGTCT CCATGGCCACGCGCTCGTGTGTATCGCGGGGCAGCGCGGGATCTGCGGCTGCAGGACCAGTGGAAGCCGC TATTCGCGCCAAATTGGAGCAAGCCCTGAGCCCCGAGGTACTGGAGCTGCGCAACGAGAGCGGTGGCCAC GCAGTCCCAGCAGGCAGCGAGACGCATTTTCGCGTGGCGGTGGTGAGCTCTCGTTTCGAGGGGATGAGCC CCTTGCAACGGCACCGGTTGGTCCACGAGGCACTGTCGGAGGAGCTGGCTGGACCGGTACATGCCCTGGC CATCCAGGCGAAGACCCCCGCCCAGTGGAGAGAAAACCCACAGTTGGACATTAGTCCCCCCTGCCTAGGT GGGAGCAAGAAAACTCGAGGGACCTCTTAATAAATACCTGGATTGGGAGAACGATCCGAATGGGTCGACT GAGAATAAACTACTACATCACTACTACCTTAAAAAAAAAAAAAAAAAAAAAA
Notes:	The probe template was PCR amplified from IMAGE:1477943 using vector (pT7T3D-PacI) specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:1477943 which was retrieved directly from NCBI.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:14477 same embryo
	EMAGE:14475 same embryo
	EMAGE:14476 same embryo
	EurExpress:euxassay_005372 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source