Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14868

Tfap2d transcription factor AP-2, delta ( MGI:2153466)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14868 EMAGE:14868 EMAGE:14868 EMAGE:14868 EMAGE:14868
"Pseudo-wholemount" of euxassay_007907. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007907_01 euxassay_007907_02 euxassay_007907_03 euxassay_007907_04
EMAGE:14868 EMAGE:14868 EMAGE:14868 EMAGE:14868 EMAGE:14868
euxassay_007907_05 euxassay_007907_06 euxassay_007907_07 euxassay_007907_08 euxassay_007907_09
EMAGE:14868 EMAGE:14868 EMAGE:14868 EMAGE:14868 EMAGE:14868
euxassay_007907_10 euxassay_007907_11 euxassay_007907_12 euxassay_007907_13 euxassay_007907_14
EMAGE:14868 EMAGE:14868 EMAGE:14868 EMAGE:14868 EMAGE:14868
euxassay_007907_15 euxassay_007907_16 euxassay_007907_17 euxassay_007907_18 euxassay_007907_19
EMAGE:14868 EMAGE:14868
euxassay_007907_20 euxassay_007907_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14868Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14868_wholemount_strong.wlz
14868_wholemount_moderate.wlz
14868_wholemount_weak.wlz
14868_wholemount_possible.wlz
14868_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14868_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 10 11 15 16 moderate expression: see section 07 08 12 13 14
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 19 20 21 weak expression: see section 01 02 05 06 07
midbrain mantle layer
strong strong
regionalstrong expression: see section 03 04 05 15 16 17 moderate expression: see section 06 07 08 10 11 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35550
Entity Detected:Tfap2d, transcription factor AP-2, delta ( MGI:2153466)
Sequence:sense strand is shown

>T35550
GGAGAAACCCATCATGTCAACTACCTTTCCCGGACTAGTCCACGATGCGGAGATACGTCACGACGGATCA
AACAGCTACCGTTTGATGCAGCTTGGCTGTCTGGAGTCCGTAGCCAATTCCACGGTTGCCTATTCCTCCT
CCTCTCCTTTAACTTACTCTACCACCGGCACCGAGTTTGCGTCCCCCTACTTCTCCACTAACCACCAGTA
CACCCCGCTCCACCACCAGTCCTTCCATTACGAGTTCCAGCACAGCCACCCGGCGGTCACTCCCGACGCC
TACTCTCTGAACTCGCTCCACCACTCACAACAGTACTACCAGCAGATTCACCACGGGGAGCCCACCGACT
TTATTAACCTGCACAATGCGCGGGCTCTCAAGTCCTCCTGCCTGGACGAGCAGAGGCGGGAGCTGGGTTG
CCTCGATGCCTACCGCCGCCACGACCTGTCCCTCATGAGCCATGGCTCTCAGTATGGAATGCACCCAGAT
CAAAGACTCCTGCCAGGGCCCAGCCTGGGGCTGGCCGCCGCGGGAGCCGACGACTTGCAGGGTTCCGTGG
AAGCCCAGTGTGGGATTGTTCTCAACGGCCAAGGGGGGGTGATCAGAAGAGGTGGCAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 66997. Forward Primer - name:066997_F_cDNA_Tcfap2d, sequence:GGAGAAACCCATCATGTCAACT; Reverse Primer - name:066997_N_SP6_cDNA_Tcfap2d, sequence:GTGCCACCTCTTCTGATCACC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14867 same embryo
 EMAGE:14866 same embryo
 EMAGE:14870 same embryo
 EMAGE:14869 same embryo
 EMAGE:14865 same embryo
 EurExpress:euxassay_007907 same experiment
 MGI:4828640 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS